Unlock instant, AI-driven research and patent intelligence for your innovation.

Sorghum C2H2 zinc finger protein gene SbZFP36 and recombinant vector and expression method thereof

A C2H2, zinc finger protein technology, applied in chemical instruments and methods, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problems that have not yet been reported on C2H2 zinc finger proteins.

Inactive Publication Date: 2019-07-05
GUIZHOU UNIV +1
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there have been no research reports on C2H2 zinc finger protein in sorghum at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sorghum C2H2 zinc finger protein gene SbZFP36 and recombinant vector and expression method thereof
  • Sorghum C2H2 zinc finger protein gene SbZFP36 and recombinant vector and expression method thereof
  • Sorghum C2H2 zinc finger protein gene SbZFP36 and recombinant vector and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Acquisition and Analysis of Sorghum C2H2 Zinc Finger Protein Gene SbZFP36

[0033] According to the protein sequence (LOC_Os03g32230) of the reported rice ZFP gene, blastP searched the sorghum genome database (https: / / phytozome) to find the sorghum homologous gene SbZFP36 (gene number is Sb08g005080, its nucleotide sequence is shown in SEQ ID NO.1 Show). Search the NCBI database with the SbZFP36 protein (its amino acid sequence is shown in SEQ ID NO.2), download the ZFP genes in other species, and use MEGA 7.0 software to construct a no root phylogenetic tree, by figure 1 It can be seen that SbZFP36 and maize ZFP are clustered together and have the closest relationship. It can be seen that the SbZFP36 gene is a sorghum C2H2 zinc finger protein.

Embodiment 2

[0034] Example 2: Construction and Identification of Sorghum C2H2 Zinc Finger Protein Gene SbZFP36 Recombinant Vector

[0035] 1. Extract sorghum RNA and reverse transcribe cDNA

[0036] The sorghum BTx623 material was taken, and the total RNA at the seedling stage was extracted with an RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and cDNA was reverse-transcribed with a reverse transcription kit (Promega).

[0037] 2. Using cDNA as a template to amplify the SbZFP36 gene;

[0038] Primers were designed to amplify the SbZFP36 gene using cDNA as a template.

[0039] Primers are as follows:

[0040] Upstream primer: SbZFP36-F: GC GGATCC ATGGTGGAACATCTCGTTATT underlined is the BamHI restriction site;

[0041] Downstream primer: SbZFP36-R:CG GAATTC TCACTCCGACATCCTGCGCTT is underlined as the EcoRI restriction site;

[0042] The upstream and downstream primers are shown in SEQ ID NO.3 and 4 respectively.

[0043]The PCR amplification system used for...

Embodiment 3

[0048] Example 3: Induced expression of SbZFP36 protein

[0049] 1. Obtain the recombinant prokaryotic expression strain of SbZFP36

[0050] The single clone successfully sequenced in Example 2 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a - The SbZFP36 recombinant expression vector was extracted, and the recombinant expression vector plasmid was transformed into Escherichia coli expression strains BL21(DE3), JM109(DE3), BL21(DE3)pLysS, Tuner(DE3), Rosetta(DE3), and the expression of SbZFP36 protein was detected.

[0051] 2. Cultivate the activated strain overnight

[0052] The above-mentioned recombinant prokaryotic expression strains were activated by culturing overnight. For example, transfer BL21(DE3), JM109(DE3), Tuner(DE3) strains to 50ug / mL kanamycin liquid medium, transfer Rosetta(DE3), BL21(DE3)pLysS strains to 50ug / mL In mL kanamycin+50ug / mL chloramphenicol liquid medium, cultivate the acti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sorghum C2H2 zinc finger protein gene SbZFP36. The nucleotide sequence of the sorghum C2H2 zinc finger protein gene SbZFP36 is shown as SEQ ID NO. 1. The invention also discloses a protein encoded by the sorghum C2H2 zinc finger protein gene SbZFP36, and the amino acid sequence of the protein is shown as SEQ ID NO. 2. The invention also discloses a recombinant vector containing the sorghum C2H2 zinc finger protein gene SbZFP36 and an expression method. According to the invention, a sorghum homologous gene SbZFP36 is obtained from a sorghum genome database through theprotein sequence of a rice ZFP gene, the full length of the gene is 711bp, a prokaryotic expression vector is constructed according to the gene, a protein purification system is used for purifying theprokaryotic expression vector, the result lays a foundation for further researching the protein crystal structure and biological characteristics, and a basis is further provided for improving the disease resistance of sorghum through a gene editing method.

Description

technical field [0001] The invention relates to a sorghum C2H2 zinc finger protein gene SbZFP36, a recombinant vector and an expression method thereof, and belongs to the field of biotechnology. Background technique [0002] Sorghum (Sorghum bicolor (L.) Moench), also known as water millet and chestnut, is an important cereal crop with strong resistance to adversity. It is an important raw material, and it is also a kind of animal husbandry crop that has been widely used in recent years. Sorghum has a long history of cultivation in my country, and it was not cultivated on a large scale before the founding of the People's Republic of China. It was not until the 1970s, with the development of economy and society, that my country gradually paid attention to and cultivated sorghum on a large scale. Sorghum is a short-day C4 plant. Compared with other energy crops, sorghum has more obvious photosynthetic efficiency and higher yield advantages, so it is known as a "high-energy cr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82C12N15/66A01H5/00A01H6/46
CPCC07K14/415C12N15/8271C12N15/66
Inventor 谢鑫蒋君梅任明见李向阳孙涛
Owner GUIZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More