Sorghum C2H2 zinc finger protein gene SbZFP36 and recombinant vector and expression method thereof
A C2H2, zinc finger protein technology, applied in chemical instruments and methods, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problems that have not yet been reported on C2H2 zinc finger proteins.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1: Acquisition and Analysis of Sorghum C2H2 Zinc Finger Protein Gene SbZFP36
[0033] According to the protein sequence (LOC_Os03g32230) of the reported rice ZFP gene, blastP searched the sorghum genome database (https: / / phytozome) to find the sorghum homologous gene SbZFP36 (gene number is Sb08g005080, its nucleotide sequence is shown in SEQ ID NO.1 Show). Search the NCBI database with the SbZFP36 protein (its amino acid sequence is shown in SEQ ID NO.2), download the ZFP genes in other species, and use MEGA 7.0 software to construct a no root phylogenetic tree, by figure 1 It can be seen that SbZFP36 and maize ZFP are clustered together and have the closest relationship. It can be seen that the SbZFP36 gene is a sorghum C2H2 zinc finger protein.
Embodiment 2
[0034] Example 2: Construction and Identification of Sorghum C2H2 Zinc Finger Protein Gene SbZFP36 Recombinant Vector
[0035] 1. Extract sorghum RNA and reverse transcribe cDNA
[0036] The sorghum BTx623 material was taken, and the total RNA at the seedling stage was extracted with an RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and cDNA was reverse-transcribed with a reverse transcription kit (Promega).
[0037] 2. Using cDNA as a template to amplify the SbZFP36 gene;
[0038] Primers were designed to amplify the SbZFP36 gene using cDNA as a template.
[0039] Primers are as follows:
[0040] Upstream primer: SbZFP36-F: GC GGATCC ATGGTGGAACATCTCGTTATT underlined is the BamHI restriction site;
[0041] Downstream primer: SbZFP36-R:CG GAATTC TCACTCCGACATCCTGCGCTT is underlined as the EcoRI restriction site;
[0042] The upstream and downstream primers are shown in SEQ ID NO.3 and 4 respectively.
[0043]The PCR amplification system used for...
Embodiment 3
[0048] Example 3: Induced expression of SbZFP36 protein
[0049] 1. Obtain the recombinant prokaryotic expression strain of SbZFP36
[0050] The single clone successfully sequenced in Example 2 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a - The SbZFP36 recombinant expression vector was extracted, and the recombinant expression vector plasmid was transformed into Escherichia coli expression strains BL21(DE3), JM109(DE3), BL21(DE3)pLysS, Tuner(DE3), Rosetta(DE3), and the expression of SbZFP36 protein was detected.
[0051] 2. Cultivate the activated strain overnight
[0052] The above-mentioned recombinant prokaryotic expression strains were activated by culturing overnight. For example, transfer BL21(DE3), JM109(DE3), Tuner(DE3) strains to 50ug / mL kanamycin liquid medium, transfer Rosetta(DE3), BL21(DE3)pLysS strains to 50ug / mL In mL kanamycin+50ug / mL chloramphenicol liquid medium, cultivate the acti...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com