Kit, RPA primer pair, probe and method for detecting CPV nucleic acid

A primer-probe and primer pair technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of long reaction time, low sensitivity and sensitivity, and achieve fast detection speed The effect of low equipment requirements and accurate detection methods

Pending Publication Date: 2019-07-05
PLANTS & ANIMALS & FOOD TESTING QUARANTINE TECH CENT SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is to provide a kind of test kit, RPA primer pair, probe and method for detecting CPV nucleic acid in order to overcome defects such as low sensitivity and sensitivity to CPV virus detection at present, and long reaction time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit, RPA primer pair, probe and method for detecting CPV nucleic acid
  • Kit, RPA primer pair, probe and method for detecting CPV nucleic acid
  • Kit, RPA primer pair, probe and method for detecting CPV nucleic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] The design of embodiment 1 real-time fluorescent PRA primer and probe

[0042] The conserved sequence of VP2 protein gene of CPV isolated from different countries and regions was analyzed by Vector NTI Suite software, and RPA primers and probes were designed by Primer Express software. Primers and probes were synthesized by Shanghai Huirui Biotechnology Co., Ltd.

[0043] Table 1 Primer pairs and probe combinations

[0044]

[0045] Among them, the nucleotide sequence composition of CPVP1 is shown as: 5'SEQ ID NO.3+FAM-dt+THF+BHQ1-dt+SEQ IDNO.4+C3Spacer 3'; the nucleotide sequence composition of CPVP2 is: 5 'SEQ ID NO.7+FAM-dt+THF+BHQ1-dt+SEQ ID NO.8+C3Spacer 3'.

Embodiment 2

[0046] The establishment and optimization of embodiment 2 reaction system

[0047] 1. Real-time fluorescent RPA detection

[0048] The reaction system is 50 μL: 25 μL 2-fold reaction buffer, 7.2 μL dNTP with an initial concentration of 11 mM, 5 μL 10-fold probe enzyme mixture, 2.1 μL each of upstream and downstream primers (CPVF, CPVR) (the initial concentration is 10 μM), the initial concentration 0.6 μL of 10 μM fluorescent probe; after mixing, add 2.5 μL of 20-fold core reaction solution, 1 μL of 50-fold RT reaction solution, and 1 μL of 50-fold Exo reaction solution; after mixing, add 2.5 μL at the end with an initial concentration of 280 mM Magnesium acetate, 1 μL nucleic acid solution to be tested. The reaction conditions are: incubate at 39°C for 25 minutes. After the reaction, check the fluorescence amplification curve and judge the result.

[0049] 2. Screening of optimal primer pairs and probe combinations

[0050] According to the above reaction system, the same...

Embodiment 3

[0064] Embodiment 3PCR detects

[0065] The PCR primers were designed for the capsid protein (VP2) gene of CPV. The size of the amplified gene fragment was 441 bp. The sequence of the upstream primer (CPVF) was: 5'ATCACAGCAAACTCAAGCAGAC3', and the sequence of the downstream primer (CPVR) was: 5'TGGAGTTGGTATGGTTGGTTTC3'. In a PCR thin-walled tube, add 1 μL of DNA template, 2.5 μL of 10-fold Taq enzyme concentration buffer, 0.5 μL of dNTP, 0.25 μL of upstream and downstream primers, 0.25 μL of Taq enzyme, and add water to make up the total volume to 25 μL. Put the PCR tube on the PCR machine, and amplify according to the following procedure: first, 94°C for 3min; then 94°C for 15s, 55°C for 15s, 72°C for 30s, 35 cycles; finally, 72°C for 3min. PCR products were analyzed by gel imaging system after agarose gel electrophoresis.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a kit, an RPA primer pair, a probe and a method for detecting CPV nucleic acid. The kit comprises an RPA reaction system, the RPA reaction system comprises an RPA primer probemixed solution, the RPA primer probe mixed solution comprises a primer pair and a probe, the nucleotide sequence of the primer pair is as shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe is as shown in 5' SEQ ID NO.3+FAM-dt+THF+BHQ1-dt+SEQ ID NO.4+C3Spacer 3'. The kit is used for detecting canine parvovirus, has short reaction time and high detection speed, and has high sensitivity and specificity.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a kit for detecting CPV nucleic acid, a pair of RPA primers, a probe and a method. Background technique [0002] Canine parvovirus disease is an acute infectious disease of dogs, caused by canine parvovirus (CPV), clinically characterized by hemorrhagic enteritis or non-suppurative myocarditis. CPV is mainly infected through direct or indirect contact, mostly in young dogs aged 3-6 months, the infection rate can be as high as 100%, and the fatality rate is 10-50%. The prevalence of the disease has no obvious seasonality. Infected dogs are the main source of infection of the disease. Once the dog group becomes ill, it is extremely difficult to completely eliminate it. Except dogs, cats, wolves, foxes, and raccoons can also be naturally infected. CPV is excreted with feces, urine, vomit and saliva, and the feces of recovered dogs can carry the virus for a long time. In ad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2600/166C12Q2531/119C12Q2563/107C12Q2521/507C12Q2521/101
Inventor 熊炜薛俊欣李健
Owner PLANTS & ANIMALS & FOOD TESTING QUARANTINE TECH CENT SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap