Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving bovine somatic cell cloning efficiency by inducing expression of zfp57

A zfp57-kz, expression vector technology, applied in the field of genetic engineering, can solve the problems of abnormal development of cloned animals and low somatic cell cloning efficiency, and achieve the effects of promoting development, improving bovine somatic cell cloning efficiency and improving embryo quality.

Active Publication Date: 2019-07-23
NORTHWEST A & F UNIV +1
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Abnormal demethylation of imprinted genes, which is ubiquitous in the reprogramming process of somatic cell cloned embryos, is an important reason for the abnormal development of cloned animals and the low efficiency of somatic cell cloning

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving bovine somatic cell cloning efficiency by inducing expression of zfp57
  • Method for improving bovine somatic cell cloning efficiency by inducing expression of zfp57
  • Method for improving bovine somatic cell cloning efficiency by inducing expression of zfp57

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1 zfp57 gene cloning

[0054] Use NCBI to search the predicted sequence of the bovine zfp57 gene, copy its transcript sequence, and mark the CDS sequence (SEQ ID NO.1). Use the Primer5 primer design software to design amplification primers (Zfp57-KZ) according to the CDS sequence of zfp57, and add the Kozak sequence (GCCACC) to its upstream primer. Due to the lack of bovine ZFP57 protein antibody, a section of Flag sequence is added before the stop codon ( CTTATCGTCGTCATCCTTGTAATC).

[0055] Wherein, the amplification primer Zfp57-KZ sequence is as follows;

[0056] Zfp57-KZ-F: GCCACC ATGGAGCCTAGTCACCCTTGGTGGC; SEQ ID NO. 2;

[0057] Zfp57-KZ-R: TCA CTTATCGTCGTCATCCTTGTAATC TTTCCCTTCTA

[0058] AGACCTTCATTGCC; SEQ ID NO. 3.

[0059] Using fetal bovine fibroblast cDNA as a template and Zfp57-KZ as a primer, the zfp57 gene was amplified by PCR to obtain a band with a size of 1713bp. The results are as follows figure 1 shown.

[0060] The PCR reaction ...

Embodiment 2

[0062] The construction of embodiment 2zfp57 gene induction expression vector

[0063] 1) The zfp57 gene fragment obtained in Example 1 is connected to the pMD-18T vector

[0064] The ligation reaction system was: 5 μL of the zfp57 gene fragment, 4 μL of Solution I, and 1 μL of the pMD-18T vector; the samples were placed in a refrigerator at 4°C overnight for ligation to obtain ligation products.

[0065] 2) The ligation product was transformed into Escherichia coli Trans5α competent cells

[0066] (1) Take 50 μL of competent cells melted on an ice bath, add 5 μL of the ligation product, mix gently, and place in an ice bath for 20 minutes;

[0067] (2) Heat shock in a water bath at 42°C for 60 seconds, then quickly transfer the tube to an ice bath for 2 minutes;

[0068] (3) Add 500 μL of sterile LB culture solution to each 1.5ml EP tube on the ultra-clean workbench, mix well, place at 37°C, incubate at 200r / min for 1 hour, and recover;

[0069] (4) After resuscitation, cen...

Embodiment 3

[0077] Example 3 Transfection of 293T cells with expression vector pTRE3G-BI-zfp57

[0078] 1) Preparation of 293T cells and fetal bovine fibroblasts (FBF)

[0079] (1) Recovery of 293T cells

[0080] Thaw 293T cells in a 37°C water bath immediately after taking them out of the liquid nitrogen tank, absorb 1mL of 37°C preheated DMEM cell culture medium (preparation: 10.4g DMEM dry powder, 3.7gNaHCO 3 , 100mL fetal bovine serum, add ultrapure water to 1L, filter and pack) into a 1.5mL centrifuge tube, then add 293T cells, centrifuge at 1000r / min for 5min, discard the supernatant, add 1mL DMEM cell culture medium to blow up the cells . Add the suspended 293T cells to a 6 cm cell culture dish (containing 3 mL of cell culture medium and 3 μL of penicillin and streptomycin double antibodies), mix well, and place in CO 2 Cell culture incubator. The addition of double antibodies can prevent bacterial contamination of freshly thawed 293T cells.

[0081] (2) Passage of 293T cells ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving bovine somatic cell cloning efficiency. By inducing the expression of zfp57 gene, the methylation of imprinted genes in the development process of a bovine cloned embryo is restored to a normal level, so that the cloning efficiency of bovine somatic cells is improved. The method for improving the bovine somatic cell cloning efficiency provided by theinvention utilizes the zfp57 to correct the abnormal low methylation of imprinted genes on the bovine cloned embryo, and makes the methylation level close to that of in vitro fertilization embryos soas to improve the embryo quality of the bovine cloned embryos, and to promote the development of the bovine cloned embryos. The method provides a theoretical basis for clarifying the mechanism of abnormal methylation imprinting in the process of reprogramming somatic cell-cloned embryos, and the reason of low efficiency of somatic cell cloning.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for improving bovine somatic cell cloning efficiency by inducing and expressing zfp57. Background technique [0002] Mammalian genes have two copies from both parents, and generally, both copies are expressed. However, there are some genes in the genome that are expressed by monoallelic genes (monoallelic expression). According to the parentage, these genes only express the alleles from one parent, while the alleles from the other parent are not expressed. Such genes are called imprinted genes, and this non-Mendelian phenomenon is called genomic imprinting. [0003] There are three main methods for somatic cell reprogramming: nuclear transfer, induction of pluripotent factors, and cell fusion, but the most mature and efficient method for somatic cell reprogramming is nuclear transfer. Somatic cell nuclear transfer has important theoretical research value an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/12C12N5/073
CPCC12N15/85C12N5/0603C12N5/0656C07K14/47C12N2800/107C12N2510/00
Inventor 苏建民张涌张成图孙洪政陈永忠孟茹安全利程宇尧王勇胜权富生
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com