Method for improving bovine somatic cell cloning efficiency by inducing expression of zfp57
A zfp57-kz, expression vector technology, applied in the field of genetic engineering, can solve the problems of abnormal development of cloned animals and low somatic cell cloning efficiency, and achieve the effects of promoting development, improving bovine somatic cell cloning efficiency and improving embryo quality.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1 zfp57 gene cloning
[0054] Use NCBI to search the predicted sequence of the bovine zfp57 gene, copy its transcript sequence, and mark the CDS sequence (SEQ ID NO.1). Use the Primer5 primer design software to design amplification primers (Zfp57-KZ) according to the CDS sequence of zfp57, and add the Kozak sequence (GCCACC) to its upstream primer. Due to the lack of bovine ZFP57 protein antibody, a section of Flag sequence is added before the stop codon ( CTTATCGTCGTCATCCTTGTAATC).
[0055] Wherein, the amplification primer Zfp57-KZ sequence is as follows;
[0056] Zfp57-KZ-F: GCCACC ATGGAGCCTAGTCACCCTTGGTGGC; SEQ ID NO. 2;
[0057] Zfp57-KZ-R: TCA CTTATCGTCGTCATCCTTGTAATC TTTCCCTTCTA
[0058] AGACCTTCATTGCC; SEQ ID NO. 3.
[0059] Using fetal bovine fibroblast cDNA as a template and Zfp57-KZ as a primer, the zfp57 gene was amplified by PCR to obtain a band with a size of 1713bp. The results are as follows figure 1 shown.
[0060] The PCR reaction ...
Embodiment 2
[0062] The construction of embodiment 2zfp57 gene induction expression vector
[0063] 1) The zfp57 gene fragment obtained in Example 1 is connected to the pMD-18T vector
[0064] The ligation reaction system was: 5 μL of the zfp57 gene fragment, 4 μL of Solution I, and 1 μL of the pMD-18T vector; the samples were placed in a refrigerator at 4°C overnight for ligation to obtain ligation products.
[0065] 2) The ligation product was transformed into Escherichia coli Trans5α competent cells
[0066] (1) Take 50 μL of competent cells melted on an ice bath, add 5 μL of the ligation product, mix gently, and place in an ice bath for 20 minutes;
[0067] (2) Heat shock in a water bath at 42°C for 60 seconds, then quickly transfer the tube to an ice bath for 2 minutes;
[0068] (3) Add 500 μL of sterile LB culture solution to each 1.5ml EP tube on the ultra-clean workbench, mix well, place at 37°C, incubate at 200r / min for 1 hour, and recover;
[0069] (4) After resuscitation, cen...
Embodiment 3
[0077] Example 3 Transfection of 293T cells with expression vector pTRE3G-BI-zfp57
[0078] 1) Preparation of 293T cells and fetal bovine fibroblasts (FBF)
[0079] (1) Recovery of 293T cells
[0080] Thaw 293T cells in a 37°C water bath immediately after taking them out of the liquid nitrogen tank, absorb 1mL of 37°C preheated DMEM cell culture medium (preparation: 10.4g DMEM dry powder, 3.7gNaHCO 3 , 100mL fetal bovine serum, add ultrapure water to 1L, filter and pack) into a 1.5mL centrifuge tube, then add 293T cells, centrifuge at 1000r / min for 5min, discard the supernatant, add 1mL DMEM cell culture medium to blow up the cells . Add the suspended 293T cells to a 6 cm cell culture dish (containing 3 mL of cell culture medium and 3 μL of penicillin and streptomycin double antibodies), mix well, and place in CO 2 Cell culture incubator. The addition of double antibodies can prevent bacterial contamination of freshly thawed 293T cells.
[0081] (2) Passage of 293T cells ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap