Corynebacterium glutamicum establishment method for increasing yield of L-lysine and improving stability of L-lysine

A technology of glutamic acid rods and construction methods, applied in the field of construction of Corynebacterium glutamicum, capable of solving problems such as strain degradation

Active Publication Date: 2019-08-09
ZHUCHENG DONGXIAO BIOTECH
View PDF7 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are many reports on improving the output of L-lysine, there is still a need for further improvement of L-lysine. In addition, most of the existing L-lysine production strains have Bacteria degradation phenomenon, so still need to improve

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Example 1: Construction of gene knockout fragments

[0074] 1) (i) extract Corynebacterium glutamicum ( Corynebacterium glutamicum ) 23604 genomic DNA, using the genomic DNA as a template, perform PCR amplification to obtain homology arms Tnp1 ;

[0075] Described PCR primer sequence is as follows:

[0076] F1: CG GGATCC CTGGGGGATCTACCAGCGGA;

[0077] R1: CATGTGAGCAAAAGGCCAGCAAAAGAATCCGCCGGAACTCG;

[0078] Described PCR amplification system is:

[0079] Reagent Volume (μL) 2×HiFi-PCR master 25 f 1 (10μmol / L)

2 R 1 (10μmol / L)

2 template 2 dd H 2 o

19

[0080] The PCR amplification procedure is as follows:

[0081] Pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 30 sec, 30 cycles; extension at 72°C for 10 min, storage at 4°C;

[0082] The PCR product was tested by agarose gel electrophoresis, the length was about 350bp, and the gel w...

Embodiment 2

[0100] Embodiment 2: preparation bacillus licheniformis competent

[0101] (i) pick Corynebacterium glutamicum ( Corynebacterium glutamicum ) 23604 single colonies, inoculated in 10mL seed medium, 37°C, 220r / min, cultured overnight;

[0102] Seed medium, the components are as follows:

[0103] Peptone 10g, yeast powder 5g, sodium chloride 10g, sorbitol 91g.

[0104] (ii) Take 1mL of the above bacterial solution and transfer it to 100mL seed medium, and cultivate it to OD at 37°C and 220r / min 600 =0.9;

[0105] (iii) Transfer the bacterial liquid to a 100mL centrifuge tube and place in an ice bath for 15-20 minutes to stop the growth of the bacterial cells;

[0106] (iv) Centrifuge at 4°C, 5000g, 5min after ice bath to collect the bacteria;

[0107] (v) The centrifuged cells were washed 3 times with pre-cooled electrotransfer buffer (ETM);

[0108] Electroporation buffer, the composition per liter is as follows:

[0109] Sorbitol 91 g, Mannitol 91 g, Glycerin 100 mL.

...

Embodiment 3

[0112] Example 3: Tnp1 -Cm r The fragment was electrotransformed into Corynebacterium glutamicum ( Corynebacterium glutamicum ) 23604

[0113] (i) will Tnp1 -Cm r restriction endonuclease Bam H I, digestion at 30°C for 3 hours;

[0114] Enzyme digestion system (40μL) is as follows:

[0115] Reagent Volume (μL) 10× K Buffer

4 Bam H I

4 Tnp1 -Cm r

20 wxya 2 o

12

[0116] (ii) Concentrate and purify the digested product

[0117] (1) Add 1 / 10 volume of 3M sodium acetate and 2.5 volumes of absolute ethanol, and place in a -20°C refrigerator for 20 minutes;

[0118] (2) Centrifuge at 12000r / min for 5min to get sediment;

[0119] (3) 300 μL of 75% ethanol to resuspend the pellet;

[0120] (4) 12000r / min, centrifuge for 5min, remove ethanol, air dry at 37°C for 30min,

[0121] (5) Add 15-18 μL ddH 2 O Resuspend DNA and store at -20°C.

[0122] (iii) Electroconversion

[0123] Firstly, the nucleic acid ultramic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a corynebacterium glutamicum establishment method for increasing the yield of L-lysine and improving the stability of the L-lysine. According to the method, after a Tnp7a geneof corynebacterium glutamicum is inactivated, the corynebacterium glutamicum is established, and an amino acid sequence of the Tnp7a gene is shown in SEQ ID NO:1. According to the corynebacterium glutamicum establishment method for increasing the yield of the L-lysine and improving the stability of the L-lysine, the endogenous gene Tnp7a of the established corynebacterium glutamicum is inactivated, the transposition effect, caused when an insertion sequence is activated due to an environment change, of the corynebacterium glutamicum in the preservation and fermentation process is lowered, thestrain degeneration progress, caused by mutation or frame shift generated by transposition or adjustment on expression of adjacent genes through promoters carried by a genome, of the genome is blocked, and the yield of the L-lysine is increased.

Description

technical field [0001] The invention relates to a method for constructing a coryneform bacterium glutamicum that improves the yield and stability of L-lysine, and belongs to the field of bioengineering. Background technique [0002] L-Lysine is a white or nearly white free-flowing crystalline powder. It is one of the important components of protein and one of the eight amino acids that humans and animals cannot synthesize by themselves but are very much needed. , so it is also called "the first essential amino acid". L-lysine has a variety of physiological functions, such as balancing amino acid composition, regulating internal metabolic balance, improving the body's absorption and utilization of cereal protein, and promoting body growth and development, so it is widely used in feed additives and food fortifiers and pharmaceutical fields. Due to the strong market demand, L-lysine has become the second largest amino acid after glutamic acid, with an annual output of about 3...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N15/54C12P13/08C12R1/15
CPCC12N15/902C12N9/1241C12P13/08
Inventor王松江郭传庄隋松森王建彬
OwnerZHUCHENG DONGXIAO BIOTECH