Staphylococcus lyase and preservation method and application thereof

A staphylococcus and preservation method technology, applied in the field of application, can solve the problems of drug resistance of phage lyase, difficult resistance of bacteria, activity reduction, etc., and achieve the effect of reducing dosage, improving bactericidal activity, and high expression level

Active Publication Date: 2019-08-13
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because its target site is a conserved component of bacteria, it is difficult for bacteria to develop resistance to it, and there is no report of bacterial resistance to phage lyase
[0004] As a protein preparation, phage lyase must have certain immunogenicity when administered in vivo, and has the disadvantage of short half-life. After long-term storage of most proteins, the activity will be greatly reduced.
Therefore, the research and development of Staphylococcus phage lyase with good bactericidal activity and good preservation activity may make the application of Staphylococcus lyase less restricted.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Staphylococcus lyase and preservation method and application thereof
  • Staphylococcus lyase and preservation method and application thereof
  • Staphylococcus lyase and preservation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Construction of Staphylococcus lyase ClyC

[0032] Through literature review and experimental verification, we found a phage lyase binding domain protein with high affinity to Staphylococcus aureus peptidoglycan, and expressed it in fusion with another phage lyase catalytic domain protein with partial catalytic activity , to get a new staphylococcal phage lyase ClyC. The primers in this experiment were completed by Shanghai Sangong Company.

[0033] (1) The DNA sequence capable of expressing the cleavage enzyme ClyC was synthesized in Shanghai Sangon Bioengineering Co., Ltd. in its entirety. Using the ClyC gene as a template, NcoI and XhoI restriction sites were added to both ends of the target gene, and the primers were designed as follows:

[0034] SEQ.ID.NO.3 forward primer: TATACCATGGGCATGGCACTGCCTAAAACGG

[0035] SEQ.ID.NO.4 reverse primer: ATATCTCGAGCGCCCATTCGATGGTGCCCCAG

[0036]Using 2 μl of the gene as a template, add 1 μl of primers for PCR a...

Embodiment 2

[0040] Example 2: ClyC kills a variety of staphylococci in vitro and specificity verification for different strains

[0041] In order to verify the bactericidal spectrum of ClyC, we selected several non-staphylococcus strains preserved in the inventor's laboratory and clinically isolated Staphylococcus aureus, Staphylococcus squirrel, Staphylococcus equus, Staphylococcus haemolyticus, Staphylococcus saprophyticus, Grape epidermidis Cocci and other strains were tested together. First, the strains to be tested were cultured overnight, collected by centrifugation, washed once with PBS, and then resuspended in PBS. Take a certain amount of ClyC and mix it with the above-mentioned bacterial solution, and at the same time use a microplate reader to detect the change in the absorption value of the mixture at 600 nm within 10 minutes. The lysis effect of different strains is indicated by the value of OD600 reduction. The killing effect obtained in the test is shown in figure 2 . ...

Embodiment 3

[0042] Example 3: Test of ClyC's ability to tolerate pH

[0043] The overnight culture of Staphylococcus aureus T23 was collected by centrifugation, washed once with PBS, and then dissolved in buffers with different pH values. Take a certain amount of ClyC and mix it with all the above bacteria solutions, and monitor the change of the absorption value of the mixed solution at 600nm with a microplate reader. After the detection, calculate the OD 600 reduction value of each group compared with the blank group, and define the value with the largest OD 600 reduction as 100%, and compare the OD 600 reduction values ​​of other groups with it to obtain the relative enzyme activity value. For the relative activity of ClyC obtained at last, see image 3 . The results show that ClyC has good activity in the range of pH 4-10, and has high activity in pH 6-10.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a lyase capable of killing staphylococcus, in particular to staphylococcus aureus, staphylococcus sciuri, staphylococcus equorum, staphylococcus haemolyticus, staphylococcus saprophyticus and other staphylococcus, and a preservation method and application of the lyase. The amino acid sequence of the staphylococcal lyase is shown as SEQ ID NO.1, and the nucleotide sequenceof a gene for encoding the staphylococcal lyase is shown as SEQ ID NO.2. The pH range of the lyase for effect exertion is wide, the activity for lysing the staphylococcus is kept at the pH of 6-10, and a recombinant protease constructed by the encoding gene can be subjected to soluble expression in escherichia coli BL21 (DE3). The lyase can be used as an antibiotic for treating in-vivo and in-vitro staphylococcal infection and can also quickly lyse the cell walls of the staphylococcus to release substances in cells, and therefore the lyase is used for nucleic acid extraction and preparation ofmedicaments for staphylococcal detection and identification. It is proved through tests that after the staphylococcus lyase is lyophilized, the bactericidal activity of the protein of the staphylococcus lyase is not reduced, and therefore the staphylococcus lyase can be prepared into lyophilized powder for storage.

Description

technical field [0001] The invention relates to the field of biological preparations, in particular to a lyase capable of killing Staphylococcus, especially Staphylococcus aureus, Staphylococcus squirrel, Staphylococcus equina, Staphylococcus hemolyticus and Staphylococcus saprophyticus, etc. Its preservation method and its application in killing and detecting staphylococcus. Background technique [0002] Staphylococcus is a Gram-positive bacterium capable of forming grape-like bacterial colonies that cause a variety of diseases in humans and animals. Staphylococcus aureus has always been a pathogenic bacterium that ranks second only to Escherichia coli in iatrogenic infections. It can cause symptoms such as meningitis, pneumonia, and sepsis. It can be transmitted through food and crowds. It is resistant to acids, alkalis, high temperatures, and low temperatures And other characteristics, can survive in a variety of complex environments. The prevalence of multidrug-resista...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12Q1/527C12Q1/14A61K38/51A61P31/04
CPCC12N9/88C12N15/70C12Q1/527C12Q1/14A61K38/00Y02A50/30
Inventor危宏平李小红杨航
OwnerWUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI