A kind of crispr/cas gene editing system and its preparation method and application

A gene editing, pcdna3.1-ljcas9 technology, applied in the field of gene editing, can solve problems such as further improvement of efficiency

Active Publication Date: 2021-05-11
QINGDAO AGRI UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cong et al. (MultiplexGenome Engineering Using CRISPR / Cas Systems.Science.2013) and Mali et al. (RNA-guided human genome engineering via Cas9.Science.2013) proved that the Cas9 system can be effective in 293T, K562, iPS and other cells. Targeted enzyme digestion, the efficiency of non-homologous recombination (NHEJ) and homologous recombination (HR) is between 3-25%, which is equivalent to TALEN enzyme digestion, but the efficiency still needs to be further improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of crispr/cas gene editing system and its preparation method and application
  • A kind of crispr/cas gene editing system and its preparation method and application
  • A kind of crispr/cas gene editing system and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0031] The invention provides a method for preparing the gene editing system, comprising the following steps:

[0032] Insert the DNA fragment encoding LjCas9 into the initial plasmid pcDNA3.1(+) to construct the pcDNA3.1-LjCas9 plasmid;

[0033] The sgRNA general expression frame DNA fragment was inserted into the initial plasmid pUC57 to obtain the pLjCas9-sgRNA plasmid.

[0034] In the present invention, the insertion site of the DNA fragment encoding LjCas9 is between the BamH I restriction site and the EcoR I restriction site of the initial plasmid pcDNA3.1 (+); in the present invention, the insertion Preferably, the DNA fragment encoding LjCas9 and the initial plasmid pcDNA3.1(+) are respectively subjected to double digestion and then ligated; the enzymes used for the double restriction are BamH I enzyme and EcoR I enzyme. In the present invention, the restriction enzyme digestion system preferably includes 1 μL of BamH I enzyme, 1 μL of EcoRI enzyme, 1 μg of DNA fragme...

Embodiment 1

[0043] Construction of CRISPR / Cas gene editing system

[0044] 1. Construction of plasmid vector pcDNA3.1-LjCas9

[0045] A 4185bp DNA fragment encoding LjCas9 (nucleotide sequence as shown in SEQ ID NO: 1) was synthesized and inserted into pcDNA3.1(+) by BamHI and EcoR I double digestion to obtain the pcDNA3.1-LjCas9 vector.

[0046] BamH I enzyme was purchased from Bao Biological Engineering (Dalian) Co., Ltd., catalog number 1010S, and EcoR I enzyme was purchased from Bao Bioengineering (Dalian) Co., Ltd., catalog number 1040S

[0047] Enzyme digestion system: 50 μL, reagents purchased from Treasure Bioengineering (Dalian) Co., Ltd.): BamH I enzyme 1 μL, EcoR I enzyme 1 μL, DNA fragment encoding LjCas9 or cDNA3.1(+) plasmid 1 μg, Buffer H 5 μL, add Double distilled water to 50 μL. The digestion temperature is 37°C, and the digestion time is 3h.

[0048] Connection steps and parameters:

[0049] Ligation system (10 μL, ligation reagent purchased from NEB Company, Cat. No...

Embodiment 2

[0082] Application of CRISPR / Cas gene editing system in gene editing of mammalian cell lines

[0083] Diqing sheep skin epithelial cell line DQSHS1 was purchased from the Kunming Cell Bank of the Chinese Academy of Sciences, number: KCB 94026.

[0084] 1. sgRNA target design

[0085] The coding region of the first exon of the sheep DKK2 gene (18259978-18260199, as shown below) was extracted from the sequence of sheep chromosome 6 (NCBI GI: 417531944), and the target site was designed.

[0086]

[0087]

[0088] Target sequence T1:

[0089] gctcacagttcggcagctcg(74-93) (SEQ ID NO: 12)

[0090] 2. Construction of sgRNA expression plasmid pair

[0091] First, send the company to synthesize single-stranded oligonucleotides according to the designed target sequence. The specific sequence is as follows:

[0092] Tj1-F: caccgctcacagttcggcagctcg (SEQ ID NO: 13)

[0093] Tj1-R: aaaccgagctgccgaactgtgagc (SEQ ID NO: 14)

[0094]Tj1-F and Tj1-R were annealed to obtain short dou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a CRISPR / Cas gene editing system and its preparation method and application, belonging to the technical field of gene editing. The CRISPR / Cas gene editing system includes a pcDNA3.1-LjCas9 plasmid and a pLjCas9-sgRNA plasmid. The application includes the following steps: determine the target sequence, design single-stranded oligonucleotide pairs; anneal to obtain double-stranded DNA fragments; connect to pLjCas9-sgRNA plasmid to obtain target sequence sgRNA expression vector; target sequence sgRNA expression vector and pcDNA3.1 ‑LjCas9 plasmid co-transfected cells and cultured. The gene editing system can specifically cut target DNA, and the editing efficiency is high.

Description

technical field [0001] The invention belongs to the technical field of gene editing, and in particular relates to a CRISPR / Cas gene editing system and its preparation method and application. Background technique [0002] ZFN, TALEN and CRISPR / Cas9 targeting technologies are several genome modification technologies that are relatively mature in research. (CRISPR) / CRISPR-associated (Cas) is a continuously evolving immune defense mechanism in bacteria and archaea. CRISPR / Cas9 uses a small RNA to recognize and cut DNA to degrade foreign nucleic acid molecules. Cong et al. (MultiplexGenome Engineering Using CRISPR / Cas Systems.Science.2013) and Mali et al. (RNA-guided human genome engineering via Cas9.Science.2013) proved that the Cas9 system can be effective in 293T, K562, iPS and other cells. Targeted enzyme digestion, non-homologous recombination (NHEJ), homologous recombination (HR) efficiency is between 3-25%, which is equivalent to TALEN enzyme digestion, but the efficienc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/90C12N15/85
CPCC12N15/85C12N15/907C12N2800/107C12N2810/10
Inventor李和刚秦怀远赵金山辛京京张宁郝小静
OwnerQINGDAO AGRI UNIV