A kind of crispr/cas gene editing system and its preparation method and application
A gene editing, pcdna3.1-ljcas9 technology, applied in the field of gene editing, can solve problems such as further improvement of efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0031] The invention provides a method for preparing the gene editing system, comprising the following steps:
[0032] Insert the DNA fragment encoding LjCas9 into the initial plasmid pcDNA3.1(+) to construct the pcDNA3.1-LjCas9 plasmid;
[0033] The sgRNA general expression frame DNA fragment was inserted into the initial plasmid pUC57 to obtain the pLjCas9-sgRNA plasmid.
[0034] In the present invention, the insertion site of the DNA fragment encoding LjCas9 is between the BamH I restriction site and the EcoR I restriction site of the initial plasmid pcDNA3.1 (+); in the present invention, the insertion Preferably, the DNA fragment encoding LjCas9 and the initial plasmid pcDNA3.1(+) are respectively subjected to double digestion and then ligated; the enzymes used for the double restriction are BamH I enzyme and EcoR I enzyme. In the present invention, the restriction enzyme digestion system preferably includes 1 μL of BamH I enzyme, 1 μL of EcoRI enzyme, 1 μg of DNA fragme...
Embodiment 1
[0043] Construction of CRISPR / Cas gene editing system
[0044] 1. Construction of plasmid vector pcDNA3.1-LjCas9
[0045] A 4185bp DNA fragment encoding LjCas9 (nucleotide sequence as shown in SEQ ID NO: 1) was synthesized and inserted into pcDNA3.1(+) by BamHI and EcoR I double digestion to obtain the pcDNA3.1-LjCas9 vector.
[0046] BamH I enzyme was purchased from Bao Biological Engineering (Dalian) Co., Ltd., catalog number 1010S, and EcoR I enzyme was purchased from Bao Bioengineering (Dalian) Co., Ltd., catalog number 1040S
[0047] Enzyme digestion system: 50 μL, reagents purchased from Treasure Bioengineering (Dalian) Co., Ltd.): BamH I enzyme 1 μL, EcoR I enzyme 1 μL, DNA fragment encoding LjCas9 or cDNA3.1(+) plasmid 1 μg, Buffer H 5 μL, add Double distilled water to 50 μL. The digestion temperature is 37°C, and the digestion time is 3h.
[0048] Connection steps and parameters:
[0049] Ligation system (10 μL, ligation reagent purchased from NEB Company, Cat. No...
Embodiment 2
[0082] Application of CRISPR / Cas gene editing system in gene editing of mammalian cell lines
[0083] Diqing sheep skin epithelial cell line DQSHS1 was purchased from the Kunming Cell Bank of the Chinese Academy of Sciences, number: KCB 94026.
[0084] 1. sgRNA target design
[0085] The coding region of the first exon of the sheep DKK2 gene (18259978-18260199, as shown below) was extracted from the sequence of sheep chromosome 6 (NCBI GI: 417531944), and the target site was designed.
[0086]
[0087]
[0088] Target sequence T1:
[0089] gctcacagttcggcagctcg(74-93) (SEQ ID NO: 12)
[0090] 2. Construction of sgRNA expression plasmid pair
[0091] First, send the company to synthesize single-stranded oligonucleotides according to the designed target sequence. The specific sequence is as follows:
[0092] Tj1-F: caccgctcacagttcggcagctcg (SEQ ID NO: 13)
[0093] Tj1-R: aaaccgagctgccgaactgtgagc (SEQ ID NO: 14)
[0094]Tj1-F and Tj1-R were annealed to obtain short dou...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


