Check patentability & draft patents in minutes with Patsnap Eureka AI!

KASP-based rat genetic quality monitoring SNP marker typing method and kit

A typing method and quality monitoring technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of cumbersome methods, high prices, and difficulty in automatic application, and achieve accurate conclusions in a short time and low economic cost

Active Publication Date: 2019-11-15
SUZHOU XISHAN BIOLOGICAL TECH
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] CN109022592A discloses a kind of 13 SNP markers for 4 kinds of commonly used strains of rats Wistar, GK, BN, SD, and the selected SNP markers are developed by technologies such as high-throughput sequencing and bioinformatics analysis, which can be used for rapid identification of four kinds of rats. SNP markers of commonly used strains (Wistar, GK, BN, SD) rats, the SNP detection technology used is first-generation sequencing, the method is cumbersome, expensive, and not easy to automate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • KASP-based rat genetic quality monitoring SNP marker typing method and kit
  • KASP-based rat genetic quality monitoring SNP marker typing method and kit
  • KASP-based rat genetic quality monitoring SNP marker typing method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] The invention provides a SNP marker for monitoring the genetic quality of rats, which is screened and located based on the NCBI SNP database, and a corresponding KASP primer set is developed.

[0048] The screening and determination of SNP markers in the present invention is carried out according to the following characteristics: at least 5 SNP markers can be distinguished between two pairs of commonly used inbred strains of rat strains; covering all 20 autosomes and X chromosomes, on each chromosome Select at least 2 SNP markers, and appropriately increase the number of SNP markers for longer chromosomes, so that each marker can be mutually verified and reduce sampling errors; the more markers, the greater the probability of detecting mutations or genetic drift. Therefore, the 48 SNP markers described in the present invention were obtained by optimizing combinations from the rat SNP markers that meet the requirements and are easy to distinguish various strains. The spec...

Embodiment 2

[0050] According to the 48 SNP markers described in Example 1, a corresponding KASP primer set was designed with Primer 3 online primer design software for each marker, and the primer set was two allele-specific forward primers and a universal reverse primer, specifically The sequence information is shown in Table 2, where the KASP primer set was designed based on the Rattus norvegicus RGSC 6.0 / rn6 genome sequence; the GAAGGTGACCAAGTTCATGCT sequence in the upstream primer 1 is a FAM fluorophore; the GAAGGTCGGAGTCAACGGATT sequence in the downstream primer 2 is a HEX fluorophore.

Embodiment 3

[0052] According to the method of the present invention, 4 common inbred strains of rats are typed, and the information on the 48 SNP marker bases of the 4 common inbred strains of rats is shown in Table 3:

[0053] Table 3 Base information of 48 SNP markers of four common inbred strains of rats

[0054]

[0055]

[0056] The specific detection steps are as follows:

[0057] 1. Sample collection: The samples are 4 inbred rat strains, F344, LEWIS, BN, Wistar, 2 for each strain. After euthanizing the rats, aseptically collect 1-2 cm of rat tails, kidneys, livers, lungs and other tissues, and freeze them at -20°C for later use;

[0058] 2. Genomic DNA extraction: Take about 30 mg of tissue samples from each animal, extract genomic DNA according to the instructions of the Tissue Genomic DNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd., DP304), and store at -20°C for later use;

[0059] 3. Prepare 10 μL KASP reaction system: 2×KASP Master Mix 5 μL (KBS-1016-001)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and particularly relates to a KASP-based rat genetic quality monitoring SNP marker typing method and a kit. There are 48 SNP loci which can be detected, wherein the loci cover 20 autosomes and X sex chromosomes of a rat, at least two SNP loci are selected on each chromosome, and at least 5 SNP loci are used for distinguishing every two inbredrat strains. The method also comprises a KASP primer set and a KASP premix which are designed for a rat SNP marker. According to the method, common inbred rat strains can be effectively and rapidly distinguished, genetic homozygosity or genetic contamination of inbred rats can be effectively detected, genetic diversity of rats in a closed colony can be rapidly detected, and the rats unknown in source can be traced. The method has the advantages of high intuition, accuracy and flexibility and low cost and is suitable for automation and batch detection.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a KASP-based SNP marker typing method and kit for monitoring the genetic quality of rats. Background technique [0002] In biomedical research, the genetic quality of experimental animals is an important factor to measure its quality. The use of experimental animals with stable genetic characteristics can ensure that the experimental results have reference value and comparability. "Genome and SNP Genetic Marker Analysis of Commonly Used Strains of Rats" (South China University of Technology, Master of Engineering Thesis, April 2018) mentioned that regular genetic testing is essential: inbred animals isogenic The characteristics of sex, long-term genetic stability, uniformity, individuality, background information and relatively complete data can detect the homozygosity and genetic contamination of inbred animals, providing a basis for ensuring the reliability, stability an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6858C12Q1/6888C12N15/11
CPCC12Q1/6858C12Q1/6888C12Q2600/156C12Q2563/107C12Q2531/113
Inventor 杨玲焰王立鹏时长军
Owner SUZHOU XISHAN BIOLOGICAL TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More