KASP-based rat genetic quality monitoring SNP marker typing method and kit
A typing method and quality monitoring technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of cumbersome methods, high prices, and difficulty in automatic application, and achieve accurate conclusions in a short time and low economic cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] The invention provides a SNP marker for monitoring the genetic quality of rats, which is screened and located based on the NCBI SNP database, and a corresponding KASP primer set is developed.
[0048] The screening and determination of SNP markers in the present invention is carried out according to the following characteristics: at least 5 SNP markers can be distinguished between two pairs of commonly used inbred strains of rat strains; covering all 20 autosomes and X chromosomes, on each chromosome Select at least 2 SNP markers, and appropriately increase the number of SNP markers for longer chromosomes, so that each marker can be mutually verified and reduce sampling errors; the more markers, the greater the probability of detecting mutations or genetic drift. Therefore, the 48 SNP markers described in the present invention were obtained by optimizing combinations from the rat SNP markers that meet the requirements and are easy to distinguish various strains. The spec...
Embodiment 2
[0050] According to the 48 SNP markers described in Example 1, a corresponding KASP primer set was designed with Primer 3 online primer design software for each marker, and the primer set was two allele-specific forward primers and a universal reverse primer, specifically The sequence information is shown in Table 2, where the KASP primer set was designed based on the Rattus norvegicus RGSC 6.0 / rn6 genome sequence; the GAAGGTGACCAAGTTCATGCT sequence in the upstream primer 1 is a FAM fluorophore; the GAAGGTCGGAGTCAACGGATT sequence in the downstream primer 2 is a HEX fluorophore.
Embodiment 3
[0052] According to the method of the present invention, 4 common inbred strains of rats are typed, and the information on the 48 SNP marker bases of the 4 common inbred strains of rats is shown in Table 3:
[0053] Table 3 Base information of 48 SNP markers of four common inbred strains of rats
[0054]
[0055]
[0056] The specific detection steps are as follows:
[0057] 1. Sample collection: The samples are 4 inbred rat strains, F344, LEWIS, BN, Wistar, 2 for each strain. After euthanizing the rats, aseptically collect 1-2 cm of rat tails, kidneys, livers, lungs and other tissues, and freeze them at -20°C for later use;
[0058] 2. Genomic DNA extraction: Take about 30 mg of tissue samples from each animal, extract genomic DNA according to the instructions of the Tissue Genomic DNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd., DP304), and store at -20°C for later use;
[0059] 3. Prepare 10 μL KASP reaction system: 2×KASP Master Mix 5 μL (KBS-1016-001)...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



