Straw mixed fermentation feed and production method thereof

A technology of mixed fermentation and production method, which is applied to the preservation method of animal feed raw materials, biochemical equipment and methods, animal feed, etc., which can solve the problems such as the inability to maintain the continuity of the silage process, so as to improve the quality of feed and improve the treatment effect , cost reduction effect

Pending Publication Date: 2019-12-17
HUBEI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the biological treatment method of straw feed mainly relies on microorganisms to carry out the silage fermentation process to realize the biodegradation and biotransformation of the relevant components in the straw. Silage is the process of obtaining feed through anaerobic fermentation of straw through lactic acid bacteria. It is to keep lactic acid bacteria continuously accumulating lactic acid and maintain a low pH value, but the reproduction of lactic acid bacteria requires sufficient soluble sugar supply, and there are few soluble carbohydrates in the straw, which cannot maintain the continuity of the silage process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Straw mixed fermentation feed and production method thereof
  • Straw mixed fermentation feed and production method thereof
  • Straw mixed fermentation feed and production method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Preparation of whole cell cellulase granules

[0024] The preparation method of whole cell cellulase, comprises the steps:

[0025] (1) Construction of cellulase expression vector pHBM-368-PGK-CBH2

[0026] Insert the target gene CBH2 into the vector pHBM368-PGK by using genetic engineering technology to obtain the cellulase expression vector pHBM-368-PGK-CBH2;

[0027] The reorganization process as figure 1 Shown, according to the CBH2 gene sequence design primer Cbh2f (5'AAT TACGTA TTTGCTTTGATTGTTTTTGC 3', the underline is the SnaB I restriction site) and Cbh2r (5'TAA CCTGAGG CTAATAAGTGCTATCAATCG 3', the underline is the Eco81I restriction site), and the target gene CBH2 shown in SEQ ID NO.1 was obtained by PCR amplification.

[0028] Digest the original plasmid 368-PGK with two restriction enzymes, SnaB I and Eco81I, to expose the cohesive ends at both ends of the vector, and then recover the CBH2 obtained by PCR amplification with SnaB I and Eco81I; ...

Embodiment 2

[0037] The small-scale production method of embodiment 2 straw mixed fermented feed

[0038]In order to study whether the fermentation effect of lactic acid bacteria and whole-cell cellulase preparation is different from that of its single use, the application effect experiment is set to 5 fermentation combinations, combined with Table 1, which are: Group A (lactic acid bacteria preparation fermentation), Group B (fermentation of whole-cell Saccharomyces cerevisiae cellulase), group C (mixed fermentation of lactic acid bacteria preparation and whole-cell Saccharomyces cerevisiae cellulase), group D (commercial silage fermentation), group E (natural fermentation), and the same source The unfermented straw was set as group F, and each group was set with 3 parallel samples. In the experimental group, 50g of corn straw was added as raw material, and 100mL of fermentation additive liquid was added (biomass was calibrated by OD600). However, the nitrogen source content in the LB med...

Embodiment 3

[0041] Effect evaluation after embodiment 3 feed treatment

[0042] 1. Sensory evaluation of corn stalks after feed treatment

[0043] The sensory evaluation of fermented corn stalks is the basic evaluation index in feed application. One of the purposes of silage and other methods of straw feed treatment is to improve straw palatability, softness, odor and other indicators, increase the feed intake of poultry and livestock, so as to reduce the use of purchased feed. If the problem of poor palatability of straw cannot be improved, the purpose of subsequent feeding will not be achieved. The sensory evaluation was carried out according to the evaluation standards, and the results are shown in Table 2. The corn stalks fermented with lactic acid bacteria and whole-cell cellulase were greatly improved in terms of odor and shape. The degree of erosion and agglomeration were reduced, and the mixed fermented corn stover was generally better than other treatment combinations.

[0044...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of biological fermentation, in particular to straw mixed fermentation feed and a production method thereof. The production method of the straw mixed fermentation feed comprises the steps that (1) a mixed fermentation preparation is prepared, specifically, whole-cell cellulase and a lactic acid bacteria preparation are dissolved in water to prepare mixed fermentation liquid, and the whole-cell cellulase is recombinant saccharomyces cerevisiae secreting cellulase; and (2) the mixed fermentation liquid is mixed evenly with straw, and after mixing evenly, packaging and sealing are conducted for silage fermentation. According to the straw mixed fermentation feed, the degradation efficiency of the cellulase and hemicellulose in straw feed can be improved, the content of single cell protein in the straw feed can be improved, and the quality of the straw feed is improved.

Description

technical field [0001] The invention relates to the field of biological fermentation, in particular to a straw mixed fermented feed and a production method thereof. Background technique [0002] my country is rich in straw resources, and it is estimated that 327 million tons of corn straw are produced in my country every year. Most of the corn stalks are naturally decomposed or burned directly, which will not only destroy the organic matter of the soil surface, but also cause air pollution and endanger human health. Corn stalks are rich in organic matter, and protein and fat also occupy a certain proportion. The basic tissue composition is mainly composed of cellulose, medium cellulose and lignin. It has high development in feed, fertilizer, fuel edible fungus aggregate, processing raw materials, etc. use value. Straw feed is one of the effective ways to solve the surplus and unreasonable utilization of straw resources. At present, the main treatment methods of feed are di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A23K10/12A23K10/37A23K30/18C12N9/42C12N15/81
CPCA23K10/12A23K10/37A23K30/18C12N9/2437C12Y302/01004C12N15/81Y02P60/87
Inventor江正兵宋慧婷李华南肖文静
OwnerHUBEI UNIV