Expression and purification method of recombinant human haptoglobin beta subunit protein

A technology of haptoglobin and expression method, which is applied in the field of expression and purification of recombinant human haptoglobin β subunit protein, can solve the problems of haptoglobin reduction, increase of free hemoglobin concentration, unfavorable blood transfusion patients, etc., and achieve simple operation , low cost effect

Inactive Publication Date: 2020-01-24
INST OF ENVIRONMENTAL MEDICINE & OCCUPATIONAL MEDICINE ACAD OF MILITARY MEDICINE ACAD OF MILITARY SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that the longer the blood used for blood transfusion is stored in vitro, the concentration of free hemoglobin will increase and the haptoglobin content will decrease, so it is not good for blood transfusion patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression and purification method of recombinant human haptoglobin beta subunit protein
  • Expression and purification method of recombinant human haptoglobin beta subunit protein
  • Expression and purification method of recombinant human haptoglobin beta subunit protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Construction of recombinant expression vector pET32a(+)-HPβ

[0027] 1.1 Using chemically synthesized DNA template and PCR method to obtain human haptoglobin β subunit gene

[0028] The human haptoglobin DNA template was synthesized in General Biosystems (Anhui) Co., Ltd. and inserted into the pUC57 cloning vector. The sequence length is 1062 bp, as shown in the appendix SEQ NO.1. Using this as a template, a full-length gene fragment of human haptoglobin β subunit was amplified. Its upstream primer sequence is: CAAGG CCATGG CTCGGATCCTGGGTGGACACC (the underlined part is the Nco I restriction site); its downstream primer sequence is:

[0029] GTG CTCGAG TTAGTTCTCAGCTATGGTCTTC (the underlined part is Xho I restriction site). PCR reaction system: 1μL upstream and downstream primers, 0.2μL plasmid template, 2xPfu PCR MasterMix (Tiangen Biochemical Technology Co., Ltd., KP201) 12.5μL, ddH 2 O 10.3μL; 94°C pre-denaturation for 3min; 94°C denaturation for 30s, 55°C annealing for 30...

Embodiment 2

[0035] Expression and identification of recombinant human haptoglobin

[0036] 2.1 Pick a single colony of recombinant genetically engineered strain Shuffle T7-B-pET32a(+)-HPβ and inoculate it in 10ml LB medium (containing 100μg / mL of ampicillin), and culture overnight at 37°C with shaking at 150rpm.

[0037] 2.2 Inoculate the overnight cultured bacterial solution into 10ml fresh LB medium (containing 100μg / mL ampicillin) at a ratio of 1:9,

[0038] Incubate at 37°C and 150rpm for about 3 hours until the OD600 of the bacterial solution reaches 0.5-0.7, and when the OD600 is preferably close to 0.6, add IPTG with a final concentration of 1 mM to induce expression for 4 hours, and the expressed recombinant human haptoglobin is soluble protein and A mixture of inclusion bodies. At the same time, the engineered strain ShuffleT7-B-pET32a(+)-HPβ did not undergo IPTG induction group for control.

[0039] 2.3 After the induction culture, the culture solution was centrifuged at 12,000g for 1 ...

Embodiment 3

[0041] Purification of recombinant human haptoglobin β subunit protein

[0042] 3.1 According to the method of Example 2, induce the expression of 200mL of recombinant genetic engineering strain ShuffleT7-B-pET32a(+)-HPβ, resuspend the bacteria in an appropriate amount of pre-cooled PBS buffer, and ultrasonically break in an ice bath until the bacteria liquid turns from turbid to clear Centrifuge at 12,000g for 5 min at 4°C, and collect the supernatant. Add the supernatant solution to an equal volume of pre-cooled Soluble Binding Buffer (20mMTris-HCL (pH7.9), 500mMNaCL, 10mM imidazole), and use Kangwei's His Tag Protein Purification Kit (soluble protein) for purification.

[0043] 3.2 Load the supernatant containing soluble protein equal-fold diluted with Soluble Binding Buffer onto a Ni Sepharose chromatography column, first wash the column with 15 times the column volume of Soluble Binding Buffer, and then use Soluble with 500 mM imidazole concentration Elution Buffer (20mM Tris...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses an expression and purification method of recombinant human haptoglobin beta subunit protein. According to the invention, a human haptoglobin full-length gene is artificially synthesized, and the human haptoglobin beta subunit gene is amplified by the PCR technology; then, the gene is expressed in Escherichia coli Shuffle T7-B using a prokaryotic expression system. Afterwards, protein purification is performed using a His-tagged soluble protein purification kit to obtain the recombinant human haptoglobin beta subunit recombinant protein. The recombinant human haptoglobinbeta subunit protein prepared according to the method of the invention has the characteristics of high yield of soluble protein and simple operation, and can be used to further study the function ofthe protein to bind hemoglobin in vitro and to remove free hemoglobin from plasma.

Description

Technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for expression and purification of recombinant human haptoglobin β subunit protein. Background technique [0002] Haptoglobin (Hp) is widely present in the serum and other body fluids of humans and many mammals. Its main function is to combine with free hemoglobin (heamoglobin; Hb) to form a haptoglobin-hemoglobin complex and transport hemoglobin to Metabolism in the liver, hemoglobin contains iron ions. The binding of globin to free plasma hemoglobin can not only make hemoglobin degraded in the body and be reused, thereby avoiding the loss of hemoglobin and iron from the kidney and damage to the kidney. Hglobin is a very important endogenous protective factor for the body to prevent damage to free hemoglobin. It is mainly synthesized by liver cells and secreted into plasma. The haptoglobin can circulate in the plasma for 3.5 days, but once bound to free hemoglobin, it can...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/47C12N15/12C12N15/70C07K1/16C12R1/19
CPCC07K14/47C12N15/70
Inventor段瑞峰邓炳楠张源蒲玲玲刘伟丽王新兴王天辉陈照立
OwnerINST OF ENVIRONMENTAL MEDICINE & OCCUPATIONAL MEDICINE ACAD OF MILITARY MEDICINE ACAD OF MILITARY SCI