Application of Escherichia coli molecular chaperone GroEL/ES in synergic synthesis of plant Rubisco

A technology of molecular chaperone and Escherichia coli, which is applied in the biological field, can solve the problems of low efficiency and achieve the effect of avoiding dependence and simplifying the in vitro synthesis system

Active Publication Date: 2020-01-31
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The enzyme that catalyzes the key reaction is ribulose-1,5-bisphosphate carboxylase / oxygenase (Rubisco for short), but Rubisco fixes CO 2 The efficiency of Rubisco is very low, and improving the carboxylase activity of Rubisco becomes a target to improve crop yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Escherichia coli molecular chaperone GroEL/ES in synergic synthesis of plant Rubisco
  • Application of Escherichia coli molecular chaperone GroEL/ES in synergic synthesis of plant Rubisco
  • Application of Escherichia coli molecular chaperone GroEL/ES in synergic synthesis of plant Rubisco

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Plasmid 1: Construction of pTetlinker-AtRbcS-AtRbcL

[0041] 1. Construct the pTetlinker vector

[0042] 1. Construct the pTetlinker vector

[0043] 1. Use primers (pLCM1 For: cacggtcacactgcttccggta, pLCM1 Rev: gggatctcgaccgatgcccttgag) to PCR amplify plasmid pCDFDuet-1 (purchased from addgene: http: / / www.addgene.org / ) to obtain amplified fragment A (sequence 1 No. 1499- 3479), the amplified fragment A contains the expression cassette of the Escherichia coli CDF replicon (position 2574-3312 in sequence 1) and the spectinomycin resistance gene (position 1646-2434 in sequence 1).

[0044] 2. Use primers (pJKR-Tet For: agggcatcggtcgagatccc Gagtagggaactgccaggcatcaa, pJKR-Tet Rev3: gtgcttctcgcctgaggttCCGTGTGCTTCTCGCCTGAGGTT) to PCR amplify plasmid pJKR-H-TetR (purchased from addgene: http: / / www.addgene.org / ) to obtain amplified fragments B (sequence 2), the amplified fragment B comprises the expression cassette of the tetracycline inhibitory protein gene (sequenc...

Embodiment 2

[0068] Example 2 Plasmid 2: Construction of pT7linker1-Cpn60α1β1 / Cpn20

[0069] 1. pT7linker1 vector

[0070] 1. The artificially synthesized T7 promoter-lac operator-T7 terminator sequence shown in Sequence 5 (the sequence elements include T7 promoter (sequence 5 No. 1-19), lac operator (Sequence 5 No. 20-44 ) and T7 transcription terminator (sequence 5, 161-203)) to replace pQlinkN (Scheich, C., Kummel, D., Soumailakakis, D., Heinemann, U., Bussow, K., Vectors for co- expression of an unrestricted number of proteins, Nucleic Acids Research, 2007, Vol.35, No.6, e43.) in the Tac promoter-λt0 ter sequence (as shown in sequence 6) to obtain the pT7linker1 vector, the specific steps are as follows:

[0071] 1. Design primers (T7 box for: gtcttgaggggttttttgagtaacaacaccatttaaatgga, T7box rev: ctatagtgagtcgtattaacaattgaatctattataattgttatccgc) PCR amplification vector pQlinkN, obtain the amplified fragment H shown in sequence 7, and the amplified fragment H includes the LacI repress...

Embodiment 3

[0102] Example 3 Plasmid 3: Construction of pT7linker2-AtBSD2-AtRaf1-AtRaf2-AtRbcX2

[0103] 1. Construction of pT7linker2 vector

[0104] 1. Synthetic primers (chl-p15A for: agcggtatcagctcactcaaaggcacggtcacactgcttccg, chl-p15A rev: aatggtttcttagacgtcaggtggccacaggtgcggttgctggc) PCR amplification plasmid pACYC184 (purchased from addgene: http: / / www.addgene.org / ), The amplified fragment M shown in sequence 12 is obtained, and the amplified fragment M comprises the Escherichia coli p15A replicon (position 1215-2053 in sequence 12) and the chloramphenicol resistance gene (position 194-853 in sequence 12).

[0105] 2. Design primers (pT7linker1 for: cacctgacgtctaagaaaccatt, pT7linker1 rev: Cctttgagtgagctgataccgct) to amplify the pT7linker1 vector, and obtain the Escherichia coli Col1 replicon (sequence 7 No. 2672-3260) and the ampicillin resistance gene (Sequence 7 No. 3434-4291) amplified fragment N of the expression cassette.

[0106] 3. The amplified fragment M and the amplif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of Escherichia coli molecular chaperone GroEL / ES in synergic synthesis of plant Rubisco. The invention firstly discloses application of relevant biological materials of the Escherichia coli molecular chaperone GroEL / ES in biosynthesis of the plant Rubisco; and the Escherichia coli molecular chaperone GroEL / ES consists of GroEL protein and GroES protein. The invention further discloses a method for biologically synthesizing the plant Rubisco. A system for synthesizing arabidopsis Rubisco in an Escherichia coli MGM100 strain by using the Escherichia coli molecular chaperone GroES / EL and a plant molecular chaperone as a molecular chaperone system is constructed, the arabidopsis Rubisco can be effectively synthesized, the synthesis system of the arabidopsisRubisco is simplified, and convenience is provided for subsequent modification of Rubisco.

Description

technical field [0001] The invention belongs to the field of biotechnology. It specifically relates to the application of Escherichia coli molecular chaperone GroEL / ES in assisting the synthesis of plant Rubisco. Background technique [0002] The photosynthesis of plants is an important way to maintain the stability of the biosphere. Through a series of reactions, the H in the atmosphere 2 O and CO 2 converted into carbohydrates, i.e. CO 2 fixed. The enzyme that catalyzes the key reaction is ribulose-1,5-bisphosphate carboxylase / oxygenase (Rubisco for short), but Rubisco fixes CO 2 The efficiency of Rubisco's carboxylase is very low, and the improvement of Rubisco's carboxylase activity becomes a target for improving crop yield. Therefore, studying the biosynthesis and regulation of Rubisco has gradually become a research focus and difficulty, because the biosynthesis of Rubisco requires a complex molecular chaperone system to assist its folding and assembly. [0003] ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/245C12N15/31C12N15/70C12N1/21C12N9/88C12R1/19
CPCC07K14/245C12N9/88C12N15/70C12Y401/01039
Inventor刘翠敏刘小强胡丽霞
OwnerINST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI