Application of the Escherichia coli molecular chaperone Groel/ES in assisting the synthesis of plant rubisco
A technology of Escherichia coli and molecular chaperones, applied in the biological field, can solve the problems of low efficiency and achieve the effect of avoiding dependence and simplifying the in vitro synthesis system
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Plasmid 1: Construction of PTETLINKER-ATRBCS-ATRBCL
[0041] First, build a PTETLINKER carrier
[0042] First, build a PTETLINKER carrier
[0043] 1. Plasmid PCDFDuet-1 (PCDGAGTCGACCGCCCCTGAG) PCR (PCM1 REVGATCGTCGTCCCCCTGCTCCGTCGTCGCCCCCCTGCTGAG) PCR PCDFduet-1 (purchased from addGene: http: / / www.addgene: http: / / www.addgene.org / ) got amplified fragment a (sequence 1 No. 1499- 3479 bits), the amplified fragment A contains the expression cassette of E. coli CDF replicon (sequence 1 Episode 2574-3312) and a magnificent characterin resistance gene (sequence 1 sequence 1646-2434).
[0044] 2, with primers (pJKR-Tet For: agggcatcggtcgagatccc Gagtagggaactgccaggcatcaa, pJKR-Tet Rev3: gtgcttctcgcctgaggttCCGTGTGCTTCTCGCCTGAGGTT) PCR amplification of plasmid pJKR-H-TetR (available from addgene: http: / / www.addgene.org / ), amplified fragment B (Sequence 2), the amplified fragment B contains a tetracycline inhibited protein gene (sequence 2 No. 1404-2027) expression cassette ...
Embodiment 2
[0068] Example 2 Plasmid 2: Construction of Pt7Linker1-CPN60α1β1 / CPN20
[0069] First, PT7LINKER1 carrier
[0070] 1. T7 promoter-LAC opinion-T7 terminator sequence shown in Artificial Synthesis Sequence 5 (the sequence element includes T7 promoter (sequence 5 1-19), LAC manipulator (sequence 5, 20-44) ) And T7 transcription terminator (sequence 5th 161-203)) Replace the PQLINKN (Scheich, C., Kummel, D., Soumailakis, D., Heinemann, U., Bussow, K., Vector for CO- The Tac Proteins, Nucleic Acids Research, 2007, Vol.35, No.6, E43. The PT7LINker1 vector is obtained, and the specific steps are as follows:
[0071] 1, the design of primers (T7 box for: gtcttgaggggttttttgagtaacaacaccatttaaatgga, T7box rev: ctatagtgagtcgtattaacaattgaatctattataattgttatccgc) PCR amplification of the vector pQlinkN, the sequence obtained amplified fragment 7 H, the amplified fragment comprising LacI repressor protein gene H (SEQ ID 7 of 994-2076 Bit) expression box, Escherichia coli colipon (sequence 7, 26...
Embodiment 3
[0102] Example 3 Plasmid 3: pT7linker2 AtBSD2 AtRaf1 AtRaf2-AtRbcX2---built
[0103] I. Construction of vectors pT7linker2
[0104] 1, synthetic primers (chl-p15A for: agcggtatcagctcactcaaaggcacggtcacactgcttccg, chl-p15A rev: aatggtttcttagacgtcaggtggccacaggtgcggttgctggc) PCR amplification of the plasmid pACYC184 (available from addgene: http: / / www.addgene.org / ), Amplified fragment M shown in sequence 12, the amplified fragment contains the E. coli M p15A replicon (SEQ ID 12 bits of 1215-2053) and chloramphenicol resistance gene (sequence 194-853 of 12 bits).
[0105] 2, primers were designed (pT7linker1 for: cacctgacgtctaagaaaccatt, pT7linker1 rev: Cctttgagtgagctgataccgct) pT7linker1 amplification vector, to obtain the removal of the E. coli replicon Col1 pT7linker1 vector (Sequence 7 position of 2672-3260), the ampicillin resistance gene (SEQ first 7 3434-4291 bit) expression cassette amplified fragment N.
[0106] 3, the amplified fragment M and N amplified fragment was cloned s...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com