Application of the Escherichia coli molecular chaperone Groel/ES in assisting the synthesis of plant rubisco

A technology of Escherichia coli and molecular chaperones, applied in the biological field, can solve the problems of low efficiency and achieve the effect of avoiding dependence and simplifying the in vitro synthesis system

Active Publication Date: 2021-08-24
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The enzyme that catalyzes the key reaction is ribulose-1,5-bisphosphate carboxylase / oxygenase (Rubisco for short), but Rubisco fixes CO 2 The efficiency of Rubisco is very low, and improving the carboxylase activity of Rubisco becomes a target to improve crop yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of the Escherichia coli molecular chaperone Groel/ES in assisting the synthesis of plant rubisco
  • Application of the Escherichia coli molecular chaperone Groel/ES in assisting the synthesis of plant rubisco
  • Application of the Escherichia coli molecular chaperone Groel/ES in assisting the synthesis of plant rubisco

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Plasmid 1: Construction of PTETLINKER-ATRBCS-ATRBCL

[0041] First, build a PTETLINKER carrier

[0042] First, build a PTETLINKER carrier

[0043] 1. Plasmid PCDFDuet-1 (PCDGAGTCGACCGCCCCTGAG) PCR (PCM1 REVGATCGTCGTCCCCCTGCTCCGTCGTCGCCCCCCTGCTGAG) PCR PCDFduet-1 (purchased from addGene: http: / / www.addgene: http: / / www.addgene.org / ) got amplified fragment a (sequence 1 No. 1499- 3479 bits), the amplified fragment A contains the expression cassette of E. coli CDF replicon (sequence 1 Episode 2574-3312) and a magnificent characterin resistance gene (sequence 1 sequence 1646-2434).

[0044] 2, with primers (pJKR-Tet For: agggcatcggtcgagatccc Gagtagggaactgccaggcatcaa, pJKR-Tet Rev3: gtgcttctcgcctgaggttCCGTGTGCTTCTCGCCTGAGGTT) PCR amplification of plasmid pJKR-H-TetR (available from addgene: http: / / www.addgene.org / ), amplified fragment B (Sequence 2), the amplified fragment B contains a tetracycline inhibited protein gene (sequence 2 No. 1404-2027) expression cassette ...

Embodiment 2

[0068] Example 2 Plasmid 2: Construction of Pt7Linker1-CPN60α1β1 / CPN20

[0069] First, PT7LINKER1 carrier

[0070] 1. T7 promoter-LAC opinion-T7 terminator sequence shown in Artificial Synthesis Sequence 5 (the sequence element includes T7 promoter (sequence 5 1-19), LAC manipulator (sequence 5, 20-44) ) And T7 transcription terminator (sequence 5th 161-203)) Replace the PQLINKN (Scheich, C., Kummel, D., Soumailakis, D., Heinemann, U., Bussow, K., Vector for CO- The Tac Proteins, Nucleic Acids Research, 2007, Vol.35, No.6, E43. The PT7LINker1 vector is obtained, and the specific steps are as follows:

[0071] 1, the design of primers (T7 box for: gtcttgaggggttttttgagtaacaacaccatttaaatgga, T7box rev: ctatagtgagtcgtattaacaattgaatctattataattgttatccgc) PCR amplification of the vector pQlinkN, the sequence obtained amplified fragment 7 H, the amplified fragment comprising LacI repressor protein gene H (SEQ ID 7 of 994-2076 Bit) expression box, Escherichia coli colipon (sequence 7, 26...

Embodiment 3

[0102] Example 3 Plasmid 3: pT7linker2 AtBSD2 AtRaf1 AtRaf2-AtRbcX2---built

[0103] I. Construction of vectors pT7linker2

[0104] 1, synthetic primers (chl-p15A for: agcggtatcagctcactcaaaggcacggtcacactgcttccg, chl-p15A rev: aatggtttcttagacgtcaggtggccacaggtgcggttgctggc) PCR amplification of the plasmid pACYC184 (available from addgene: http: / / www.addgene.org / ), Amplified fragment M shown in sequence 12, the amplified fragment contains the E. coli M p15A replicon (SEQ ID 12 bits of 1215-2053) and chloramphenicol resistance gene (sequence 194-853 of 12 bits).

[0105] 2, primers were designed (pT7linker1 for: cacctgacgtctaagaaaccatt, pT7linker1 rev: Cctttgagtgagctgataccgct) pT7linker1 amplification vector, to obtain the removal of the E. coli replicon Col1 pT7linker1 vector (Sequence 7 position of 2672-3260), the ampicillin resistance gene (SEQ first 7 3434-4291 bit) expression cassette amplified fragment N.

[0106] 3, the amplified fragment M and N amplified fragment was cloned s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of an Escherichia coli molecular chaperone GroEL / ES in assisting the synthesis of plant Rubisco. The invention firstly discloses the application of related biological materials of Escherichia coli molecular chaperone GroEL / ES in biosynthesizing plant Rubisco; the Escherichia coli molecular chaperone GroEL / ES is composed of GroEL protein and GroES protein. The invention further discloses a method for biosynthesizing plant Rubisco. The present invention constructs a system for synthesizing Arabidopsis Rubisco in Escherichia coli MGM100 strain with the Escherichia coli molecular chaperone GroES / EL and the plant molecular chaperone as the molecular chaperone system, which can effectively synthesize Arabidopsis Rubisco and simplify the preparation of Arabidopsis Rubisco The synthesis system provides convenience for the subsequent transformation of Rubisco.

Description

Technical field [0001] The invention belongs to the field of biotechnology. Specific applications involving E. coli molecular partners GROEL / ES in assisting in synthetic plants Rubisco. Background technique [0002] The photosynthesis of plants is an important passage of maintaining the stability of the biosphere, through a series of reactions, hidden in the air 2 O and CO 2 Convert to carbohydrate, ie CO 2 Fixed. Among them, enzymes are enzymes for keronose-1,5-diphosphate / oxygen-1,5-biphosphate carboxylase / oxygenase, referred to as Rubisco, but Rubisco fixed CO 2 The efficiency is very low, and the carboxylase activity of Rubisco is improved to increase crop yield. Therefore, studying the biosynthesis and regulation of Rubisco gradually became a hot spot and difficult point of research, because Rubisco's biological synthesis requires complex molecular partner system to assist in folding and assembly. [0003] Therefore, it is urgently needed to develop a new, simple molec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/245C12N15/31C12N15/70C12N1/21C12N9/88C12R1/19
CPCC07K14/245C12N9/88C12N15/70C12Y401/01039
Inventor刘翠敏刘小强胡丽霞
OwnerINST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI