A kind of kdta gene modified recombinant strain and its construction method and application
A technology for recombinant strains and strains, applied in the field of genetic engineering and microorganisms, can solve the problems of multiple by-products, slow growth of strains, difficulty in obtaining high-yield strains, etc., and achieve the effect of reducing production costs and improving the stability of strains
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046]Example 1 Construction of plasmid pKOⅤ-kdtA for site-directed mutation (G82A) of the kdtA gene coding region (G82A)
[0047] (The 28th alanine in the amino acid sequence SEQ ID NO:3 corresponding to the wild-type encoded protein is replaced by threonine (A28T))
[0048] 3-Deoxy D-mannose-sulfamate transferase is encoded by the kdtA gene. In the E.coli K12 strain and its derivative strains (such as MG1655, etc.), the wild-type kdtA gene ORF sequence is Genbank accession number CP032667.1 Shown in sequence 73556-74833. Based on the sequence, two pairs of primers for amplifying kdtA were designed and synthesized, and a vector was constructed to change the 82nd base G in the sequence of the kdtA gene coding region in the starting strain to A. The primers were designed as follows (synthesized by Shanghai Invitrogen Company): P1: 5'CGGGATCCACCAGTGAACCGCCAACA 3' (the underlined part is the restriction endonuclease cutting site BAMH I) (SEQ ID NO: 5)
[0049] P2: 5'TGCGCGGACG...
Embodiment 2
[0053] Embodiment 2 comprises the construction of the engineering bacterial strain of point mutation gene kdtA (G82A)
[0054] Both wild-type Escherichia coli strain E.coli K12 (W3110) and high-yield L-threonine strain E.coli CGMCC7.232 (preserved to China General Microbiological Culture Collection Center, China General Microbiological Culture Collection Center) both retain wild-type kdtA gene. The constructed plasmid pKOⅤ-kdtA(G82A) was transformed into E.coli K12(W3110) and E.coli CGMCC 7.232 respectively, and the 82nd base of the kdtA gene sequence in the chromosomes of these two strains was replaced by allele replacement. G becomes A. The specific process is as follows: transform the plasmid pKOⅤ-kdtA(G82A) into competent cells of the host bacteria by electroporation, and then add 0.5 mL of SOC liquid medium; revive in a shaker at 30°C and 100 rpm for 2 hours; take 100 μL of culture solution to spread In LB solid medium with chloramphenicol content of 34mg / mL, culture at...
Embodiment 3
[0058] Embodiment 3 threonine fermentation experiment
[0059] E.coli K12 (W3110) strain, E.coli CGMCC 7.232 strain, and mutant strains YPThr07 and YPThr08 were respectively inoculated in 25 mL of the liquid medium described in Table 1, and cultured at 37° C. and 200 rpm for 12 hours. Then, 1 mL of the culture of each strain was inoculated into 25 mL of the liquid medium described in Table 1, and fermented at 37° C. and 200 rpm for 36 hours. The content of L-threonine was determined by HPLC, three parallels were performed for each strain, and the average value was calculated. The test results are shown in Table 2.
[0060] Table 1 medium formula
[0061] Element Formula g / L glucose 40 ammonium sulfate 12 Potassium dihydrogen phosphate 0.8 Magnesium Sulfate Heptahydrate 0.8 Ferrous Sulfate Heptahydrate 0.01 Manganese Sulfate Monohydrate 0.01 Yeast extract 1.5 calcium carbonate 0.5 L-methionine 0.5 Potassium ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More