Nested duplex PCR detection primer and kit for distinguishing wild strain and gene deleted strain of African Swine Fever Virus (ASFV)

A technology for African swine fever virus and gene deletion, which is applied in the field of virus strain identification, can solve the problems of unfavorable rapid identification, low sensitivity, and cumbersome steps, and achieve the effects of reduced detection time, high sensitivity, and good repeatability

Active Publication Date: 2020-02-18
SOUTH CHINA AGRI UNIV +1
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are cumbersome steps, which are not conducive to rapid identification, and the sensitivity of ordinary PCR methods is relatively low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nested duplex PCR detection primer and kit for distinguishing wild strain and gene deleted strain of African Swine Fever Virus (ASFV)
  • Nested duplex PCR detection primer and kit for distinguishing wild strain and gene deleted strain of African Swine Fever Virus (ASFV)
  • Nested duplex PCR detection primer and kit for distinguishing wild strain and gene deleted strain of African Swine Fever Virus (ASFV)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Primer Design

[0053] The inventor compared a large number of CD2V and 360-505R genes of African swine fever virus (ASFV) published in the GenBanK database of NCBI (National Center for Bioinformatics of the United States) with highly conserved and specific regions, and designed ASFV CD2V and 360-505R genes Because of the specific outer primer pair and inner primer pair, the outer primer pair was named P1, P2, P3, and P4, respectively; the inner primer pair was named P5, P6, P7, and P8, respectively. The location of the primers is attached figure 1 shown. Thus, a kind of nested PCR primer for distinguishing ASFV wild-type strain and gene-deleted strain is provided, specifically:

[0054] Outer primer set:

[0055] P1: ASFV-CD2V-F1: 5'GATAATTTCGCCACCGCACTAG 3', as shown in SEQ ID NO: 1;

[0056] P2: ASFV-CD2V-R1: 5'CTGTGGGCCTCATTTTTCGTT 3', as shown in SEQ ID NO: 2;

[0057] P3:ASFV-360-505R-F1: 5'TCATTTAGAGAAGGTCATCATAGGAGC 3', as shown in SEQ ID NO:3;

...

Embodiment 2 3

[0068] Embodiment 2 Triple PCR detection method

[0069] Materials and Methods

[0070] 1.1 Primers in Example 1

[0071] 1.2 Sample DNA extraction

[0072] There are no special requirements for DNA extraction, which can be extracted according to conventional methods or DNA extraction kits. The extracted DNA was stored at -20°C for later use or immediately used for PCR amplification.

[0073] 1.3 Positive plasmid

[0074] The full-length ASFV CD2V and 360-505R genes published in the GenBanK database plus the partial sequences on both sides were artificially synthesized, connected to the pUC57 vector, transformed into E. On the LB medium plate of mycin, culture at 37°C for 12-16h. After the bacteria were picked, screened and identified by sequencing, the plasmids were extracted after expanding the culture of positive bacteria. The positive plasmids were named pUC57-CD2V and pUC57-360-505R respectively.

[0075] After manual comparison of the published ASFV CD2V gene and th...

Embodiment 3

[0088] Embodiment 3 specificity test

[0089] According to the nested double PCR detection method established in 1.4 of Example 2, pair 1: wild strain without gene deletion; 2: deletion of CD2V and 360-505R strain; 3: mixture of deletion of CD2V and 360-505R strain and wild strain ; 4: positive plasmid (CD2V); 5: negative control (deionized water); 6: classical swine fever virus (CSFV); 7: porcine pseudorabies virus (PRV); 8: porcine reproductive and respiratory syndrome virus (PRRSV ); 9: porcine parvovirus (PPV); 10: porcine encephalitis virus (JEV); 11: rotavirus (RV); 12: porcine epidemic diarrhea virus (PEDV); 13: porcine deltacoronavirus (PDCoV); 14: Porcine circovirus Ⅱ (PCV2) was detected. The results are attached image 3 shown.

[0090] From attached image 3 As can be seen in the figure, corresponding to 1: wild strain without gene deletion; 2: deletion of CD2V and 360-505R strain; 3: mixture of deletion of CD2V and 360-505R strain and wild strain; 4: lane of po...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a nested duplex PCR detection primer and kit for distinguishing a wild strain and a CD2V and / or 360-505R gene deleted strain of an African Swine Fever Virus (ASFV); and nucleotide sequences for eight pairs of detection primers are as shown in SEQ ID NO: 1-8. According to the nested duplex PCR detection primer and kit provided by the invention, the eight pairs of primers areused to amplify CD2V and 360-505R genes of the ASFV in a nested duplex manner, so that the detection cost and detection time for identifying different genes are reduced; whether a strain has gene deletion and mixed infection may be identified; for a traditional nested PCR that merely amplifies one gene at each time, the nested duplex PCR detection primer and kit amplify two genes simultaneously in each PCR reaction, so the cost is reduced by about 1 / 2; and for a common duplex PCR, the nested duplex PCR detection primer and kit provided by the invention improve the sensitivity by 10<10> ordersof magnitudes or more, may reach 1*10<-18> ng / [mu]L in sensitivity, and have a wide market prospect.

Description

technical field [0001] The invention relates to the technical field of virus strain identification methods, and more specifically relates to a nested double PCR detection primer and a kit for distinguishing African swine fever virus wild strains from CD2V and / or 360-505R gene deletion strains. Background technique [0002] African swine fever (ASF) is caused by African swine fever virus (ASFV), which can cause acute hemorrhagic fever, resulting in a large number of morbidity and mortality events (mortality close to 100%) in pigs. The World Organization for Animal Health (OIE) listed it as a must-report animal disease, and my country listed it as a first-class animal disease. Since the first case of African swine fever broke out in my country in 2018, African swine fever has caused major losses to my country's pig industry and seriously affected the healthy development of my country's pig industry. African swine fever has spread to many countries in Asia. The impact of Afri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/6848C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6848C12Q2600/16C12Q2531/113C12Q2537/143C12Q2549/119Y02A50/30
Inventor沈永义张旭陈瑞爱沈雪娟
OwnerSOUTH CHINA AGRI UNIV