Application of rice tRNA isopentenyl transferase gene OsIPT9 in brown planthopper resistance of rice

An isopentenyl, brown planthopper-resistant technology, applied in the field of plant genetic engineering, can solve problems such as failure to detect cZ, and achieve the effect of improving resistance

Active Publication Date: 2020-02-21
WUHAN UNIV +1
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that AtIPT2 exhibits tRNA-IPT activity in vitro; double mutants of AtIPT2 and AtIPT9 failed to detect cZ in vivo (Miyawaki et al., 2006)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice tRNA isopentenyl transferase gene OsIPT9 in brown planthopper resistance of rice
  • Application of rice tRNA isopentenyl transferase gene OsIPT9 in brown planthopper resistance of rice
  • Application of rice tRNA isopentenyl transferase gene OsIPT9 in brown planthopper resistance of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] [Example 1] Obtaining rice OsIPT9 gene

[0036] A tRNA isopentenyl transferase OsIPT9 was found by screening the interaction protein of the anti-brown planthopper gene Bph6 in the rice 9311 library, and the ORF sequence and genomic sequence of the gene were amplified by designing primers in the cDNA of Nipponbare.

Embodiment 2

[0037] [Example 2] Subcellular localization of OsIPT9 gene in rice

[0038] Design primers at both ends of the full-length ORF of OsIPT9 gene, add BamHI restriction sites and protective bases, after the amplified fragments are recovered, they are digested with BamHI enzymes and connected to the vector PCXUN::GFP digested with the same enzymes , Send the positive clone to sequencing, confirm that it is a forward-ligated plasmid without mutation, and transform the plasmid into protoplasts. The specific process is as follows:

[0039] The rice seeds were sown in 1 / 2MS medium and cultured in a dark incubator at 28°C for 10 to 12 days. Take about 100 seedlings, use a blade to cut the stems into small segments of about 0.5 mm, equilibrate in 0.6M mannitol for 10 minutes, transfer to the enzymatic hydrolysis solution, and cultivate in the dark at 28°C and 80 rpm for 4-5 hours. Add 10ml of W5 solution to the enzymolysis solution to stop the reaction, and filter to obtain a protoplast sus...

Embodiment 3

[0040] [Example 3] OSIPT9 gene overexpression, CRISPR / Cas9 vector construction and Agrobacterium-mediated genetic transformation

[0041] 1. Construction of OsIPT9 overexpression vector

[0042] The inventor intercepted a segment of the designed primers from both ends of the ORF of OsIPT9, the sequence is as follows:

[0043] OEV-F: ATGGCCCACCTCGCGGCCTCTG(5'-3')

[0044] OEV-R: CTATAATGATATCACTGTACTAGCC(5'-3')

[0045] The vector used is pCXUN (provided by Professor Wang Guoliang from Ohio State University, USA). The pCXUN vector is digested with XcmI, and the foreign fragment can be directly connected after adding A. According to the series of SEQ ID No. 2, the ORF is directly amplified by PCR, and then connected to the vector after adding A. After the sequencing verification is correct, the obtained vector is the OsIPT9 gene overexpression vector, which is electrotransformed into Agrobacterium EHA105. Pick a single clone to expand the culture, and after PCR verification is correct,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a rice tRNA isopentenyl transferase gene OsIPT9 in brown planthopper resistance of rice, which belong to the technical field of plant genetic engineering. TheOsIPT9 has an amino acid sequence as shown in SEQ ID No. 1, the nucleotide sequence of the OsIPT9 is as shown in SEQ ID No. 2, and the ORF sequence of the OsIPT9 is as shown in SEQ ID No. 3. The OsIPT9 is transferred into Nipponbare which is sensitive to the brown planthopper through agrobacterium-mediated genetic transformation, and the resistance of overexpressed plants to the brown planthopperis enhanced; meanwhile, in a resistant material NIP-Bph6-NIL, the OsIPT9 is knocked out by utilizing a CRISPR / Cas9 technology, so that the resistance of the plant to the brown planthopper is remarkably reduced. The gene disclosed by the invention provides a good theoretical basis for researching gene interaction between rice and brown planthopper, and has reference significance for researching gene molecular functions and breeding.

Description

Technical field [0001] The invention belongs to the field of plant genetic engineering, and specifically relates to the application of rice tRNA isopentenyl transferase gene OsIPT9 in rice resistance to brown planthopper. Background technique [0002] Rice (Oryza sativa) is one of the most important food crops in my country. Rice production is directly related to my country’s food security, farmers’ income increase and rural stability. Rice planthopper is the primary pest with the largest occurrence and damage area in rice production. There are three main types of rice planthoppers that damage rice: brown planthopper, white-backed planthopper, and white planthopper, among which the main one is brown planthopper. Brown planthopper (BPH; Nilaparvata ) Is a typical piercing-sucking insect type. The brown planthopper can cause direct and indirect damage to rice. The direct damage is caused by the needle-like mouthparts sucking the phloem juice of rice (Wang et al., 2008; Cheng et ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N15/82A01H5/00A01H6/46
CPCC12N9/1085C12N15/8286C12Y205/01075
Inventor何光存郭建平杜波陈荣智祝莉莉
OwnerWUHAN UNIV