Application of phosphoserine aminotransferase gene in promoting plant growth and improving salt resistance

A phosphoserine amino, plant growth promotion technology, applied in the field of plant genetic engineering, can solve problems such as unexplained plant resistance, and achieve the effect of promoting salt resistance and strong stress resistance

Inactive Publication Date: 2020-03-31
TIANJIN TEDA GREEN GRP CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Overexpression of a PGDH gene from a species of algae in Arabidopsis improved salt and cold tolerance, but the study did not explain how serine or the gene affected plant resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of phosphoserine aminotransferase gene in promoting plant growth and improving salt resistance
  • Application of phosphoserine aminotransferase gene in promoting plant growth and improving salt resistance
  • Application of phosphoserine aminotransferase gene in promoting plant growth and improving salt resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Preparation and detection of Arabidopsis total RNA

[0039] The extraction of Arabidopsis total RNA uses the reagent in TRIzoL Reagent (purchased by Invitrogen Company), and proceeds as follows: take 0.1 g of leaves of 7-10 day seedling age, add 1 ml of TRIzoL RNA extract, mix well and let stand at room temperature for 5 min, add 0.2ml chloroform, shake and mix well, 4°C, centrifuge at 12000rpm / min for 15min; transfer the supernatant, add 0.5ml isopropanol, mix well at room temperature for 10min, then centrifuge at 12000rpm / min for 10min; discard the supernatant, 1ml of 75% ethanol Wash the precipitate, centrifuge at 7500rpm / min at 4°C for 5min, dry the precipitate in vacuo, dissolve the RNA with 20 μl of diethylpyrocarbonate (DEPC) in water, and take 1ul of RNA at -20°C for electrophoresis detection on 1.2% agarose gel. The results showed that the quality of the extracted RNA met the requirements.

Embodiment 2

[0040] Example 2: Synthesis of Arabidopsis cDNA

[0041] Using Arabidopsis total RNA as a template, use RevertAidTM-MuLV Reverse Transcriptase Kit (Fermentas) for cDNA synthesis. Take 0.25 μg of total plant RNA, 50 ng of oligo(dT), 1 μl of 10 mM dNTP mix, and make up to 10 μl with DEPC-treated water. After mixing, it was centrifuged briefly to collect it at the bottom of the tube, heated in a constant temperature dry heat heater at 65°C for 5 minutes, and ice-bathed for 10 minutes. RNase inhibitor 1μl), mix well, briefly centrifuge to collect it at the bottom of the tube, incubate at 25°C for 2min, add 1μl RevertAidTM-MuLV Reverse Transcriptase, mix well and incubate at 25°C for 20min, then incubate at 42°C for 70min, in an ice bath for 10min, -20 Store at ℃ for later use.

Embodiment 3

[0042] Embodiment 3: Obtaining the full-length sequence of AtPSAT1 gene

[0043] PCR primers were designed according to the AtPSAT1 gene fragment and synthesized by Shanghai Bioengineering Company.

[0044] PSAT-fw-Nco I CCATGGGGATGGCGGCTACGACGAAC PSAT-rev-BstE II GGGTTACCCTAAGCATGCTTAGCCTGG

[0045] The PCR reaction system is:

[0046] 10×PCR buffer 2.5μl dNTP mixture (10mM) 0.5μl upstream primer 0.5μl downstream primer 0.5μl cDNA 0.5μl Taq plus 0.3μl h 2 o

15.2μl Total volume 20μl

[0047] The PCR reaction program is: pre-denaturation at 94°C for 3 minutes, followed by the following cycles: denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 60 s, a total of 31 cycles, and finally extension at 72°C for 10 min;

[0048] The above target product amplified by PCR was recovered and purified using an agarose gel electrophoresis recovery kit ( figure 2 ), an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of a phosphoserine aminotransferase gene in promoting plant growth and improving salt resistance and a method thereof, and the phosphoserine aminotransferase genehas a good application prospect in agricultural production.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to an application and method of controlling serine synthesis in plants, promoting growth and improving salt resistance genes in agricultural production, and is a new method for cultivating high-yield and salt-resistant plants using biogenetic engineering technology. Germplasm method. Background technique [0002] L-serine (L-Serine, L-Ser) is a very important amino acid in organisms. In addition to being an important component of protein and playing a catalytic role in many enzyme active centers, L-serine is also a biological macromolecule necessary for many cell life activities, such as the substrate for the synthesis of amino acids such as glycine, tryptophan and cysteine. It also participates in nitrogen metabolism, sphingomyelin, lipid metabolism and one-carbon unit metabolism, and is also related to resistance. [0003] The various life activities of plants ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/82A01H5/00A01H6/00
CPCC12N9/1096C12N15/8261C12N15/8273C12N15/8251C12N15/8243C12Y206/01052
Inventor韩晓芳杨永利张清王勇
OwnerTIANJIN TEDA GREEN GRP CO LTD