Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of nanobody

A nano-antibody and antigen technology, applied in the biological field, can solve the problems of easy anti-antibody reaction, easy aggregation, precipitation, large molecules, etc., and achieve the effect of meeting the secretion function characteristics, convenient and fast technology, and small molecular weight

Inactive Publication Date: 2020-04-07
山东民康生物科技有限公司 +1
View PDF11 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional antibody drugs have some unavoidable shortcomings: large molecules, difficult to penetrate tissues and cells, especially physiological barriers such as the blood-brain barrier; easy to aggregate and precipitate during preparation, storage and transportation; easy to trigger anti-antibody reactions; screening Less chance of finding biologically active high-affinity antibodies
In addition, the production cycle of nanobody preparation based on phage display technology is too long. It usually takes 4-5 months from library preparation to antibody acquisition. Phage display technology is complex, costly and difficult to master

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of nanobody
  • Preparation method of nanobody
  • Preparation method of nanobody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The preparation of a single B cell clone and the screening of positive clones include the following steps:

[0041] (1) 30 mL of anticoagulated alpaca peripheral blood before immunization was taken as a negative control, PBMCs were separated by density gradient centrifugation, B cells were separated from PBMCs with CD138 antibody-coated immunomagnetic beads, and the enriched B cells were placed in Store in cell freezing solution and liquid nitrogen for later use.

[0042] (2) Mix the extracted natural human serum albumin with Freund's adjuvant at a ratio of 1:1, inject 6-7 μg / kg subcutaneously into the back of each alpaca, and immunize 4 times with an interval of 2 weeks. At the end of the immunization program, 30 mL of anticoagulated peripheral blood from alpacas was collected, and PBMCs were separated by density gradient centrifugation, and B cells were enriched.

[0043] (3) Take 10mg of human serum albumin and use Alexa Fluor TM The 488Antibody Labeling Kit is us...

Embodiment 2

[0047] Recombinant expression and purification of Nanobodies, comprising the following steps:

[0048] (1) Use Qiangen TM miRNeasy Micro Kit extracts the total RNA of a single selected B cell clone, and proceeds according to the kit instructions.

[0049] (2) Use One Step TB Green TM PrimeScript TM PLUS RT-PCR Kit amplifies VHH fragments in one step. The sequences of upstream and downstream primers used are shown in SEQ ID NO.1 (CCATATGGGTCCTGGCTGCTCTTCTACAAGG) and SEQ ID NO.2 (TTGCGGCCGCAACGCCATCAAGGTACCAGTTGA), and the 5' end of SEQ ID NO.1 contains Nde I digestion site, the 5' end of SEQ ID NO.2 contains a Not I restriction site. Prepare the RT-PCR reaction solution according to the following components (please prepare the reaction solution on ice). 2X One Step TB Green RT-PCR Buffer10μl, TaKaRa Ex Taq HS Mix 1.2μl, PrimeScript PLUS RTase Mix 0.4μl, PCR Forward Primer (10μM) 0.8μl, PCR ReversePrimer (10μM) 0.8μl, Total RNA 2μl, RNase Free dH 2 O 4.8 μl, total volume 20...

Embodiment 3

[0060] Nanobody activity identification, including the following steps:

[0061] (1) Human serum albumin was diluted with coating solution and then coated with 100 ng / well of the microtiter plate, overnight at 4°C.

[0062] (2) Pour off the coating solution, wash the microplate with 200 μL PBS 5 times, and beat the plate on absorbent paper to ensure that the washing solution is completely drained.

[0063] (3) Add 200 μL of 5% skimmed milk powder to each well and block for 1 hour at room temperature.

[0064] (4) prepare nanobody dilution solution, concentration is from

[0065] (5) Wash the microtiter plate 5 times with 200 μL of PBS, add 100 μL of purified anti-human serum albumin nanobody, blank control, and positive control to each well, and incubate at room temperature for 2 hours.

[0066] (6) Wash the microtiter plate 5 times with 200 μL PBS, add 100 μL HRP-labeled antibody, and incubate at room temperature for 1 hour.

[0067] (7) Wash the microtiter plate 5 times w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a nanobody. The preparation method comprises the following steps: immunizing animals with a target antigen to obtain peripheral blood mononuclear cellsof the immunized animals, and enriching B cells; marking the target antigen by using FITC fluorescence; culturing the cells by using a semi-solid culture medium to form independent single B cell clones, selecting single B cell clones secreting positive heavy-chain antibodies, extracting total RNAs of positive B cells, carrying out reverse transcription to obtain cDNAs, and carrying out VHH fragment amplification and sequencing; and performing recombinant expression and activity identification of the nanobody. According to the method, the positive B cell clones secreting VHH antibodies can be directly observed and selected, and fluorescence signals are formed through the secreted antibodies, so the secretion functional characteristics of B cell antibodies are better conformed to. The nanobody screened and prepared by the method has the advantages of small molecular weight, strong stability, high affinity, good solubility, easiness in expression and the like, and has a wide application scope.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to a method for preparing nano-antibodies, which can quickly select and prepare antigen-specific nano-antibodies. Background technique [0002] Mammalian (including human) antibodies are generally composed of two heavy chains and two light chains, and the Fc region of the heavy chain can ensure that the antibody has a longer half-life in vivo. Traditional antibody drugs have some unavoidable shortcomings: large molecules, difficult to penetrate tissues and cells, especially physiological barriers such as the blood-brain barrier; easy to aggregate and precipitate during preparation, storage and transportation; easy to trigger anti-antibody reactions; screening The chances of finding high-affinity antibodies with biological activity are low. In 1993, Belgian scientist Hamers-Casterman discovered a new antibody in camels and alpacas. This antibody is only 1 / 10 of the traditional antibody, bu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/00C12N5/0781C12N5/10
CPCC07K16/00C07K2317/569C12N5/0635C12N2509/00C12N2510/02
Inventor 赵冠华靳昌忠
Owner 山东民康生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com