Preparation method of nanobody
A nano-antibody and antigen technology, applied in the biological field, can solve the problems of easy anti-antibody reaction, easy aggregation, precipitation, large molecules, etc., and achieve the effect of meeting the secretion function characteristics, convenient and fast technology, and small molecular weight
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] The preparation of a single B cell clone and the screening of positive clones include the following steps:
[0041] (1) 30 mL of anticoagulated alpaca peripheral blood before immunization was taken as a negative control, PBMCs were separated by density gradient centrifugation, B cells were separated from PBMCs with CD138 antibody-coated immunomagnetic beads, and the enriched B cells were placed in Store in cell freezing solution and liquid nitrogen for later use.
[0042] (2) Mix the extracted natural human serum albumin with Freund's adjuvant at a ratio of 1:1, inject 6-7 μg / kg subcutaneously into the back of each alpaca, and immunize 4 times with an interval of 2 weeks. At the end of the immunization program, 30 mL of anticoagulated peripheral blood from alpacas was collected, and PBMCs were separated by density gradient centrifugation, and B cells were enriched.
[0043] (3) Take 10mg of human serum albumin and use Alexa Fluor TM The 488Antibody Labeling Kit is us...
Embodiment 2
[0047] Recombinant expression and purification of Nanobodies, comprising the following steps:
[0048] (1) Use Qiangen TM miRNeasy Micro Kit extracts the total RNA of a single selected B cell clone, and proceeds according to the kit instructions.
[0049] (2) Use One Step TB Green TM PrimeScript TM PLUS RT-PCR Kit amplifies VHH fragments in one step. The sequences of upstream and downstream primers used are shown in SEQ ID NO.1 (CCATATGGGTCCTGGCTGCTCTTCTACAAGG) and SEQ ID NO.2 (TTGCGGCCGCAACGCCATCAAGGTACCAGTTGA), and the 5' end of SEQ ID NO.1 contains Nde I digestion site, the 5' end of SEQ ID NO.2 contains a Not I restriction site. Prepare the RT-PCR reaction solution according to the following components (please prepare the reaction solution on ice). 2X One Step TB Green RT-PCR Buffer10μl, TaKaRa Ex Taq HS Mix 1.2μl, PrimeScript PLUS RTase Mix 0.4μl, PCR Forward Primer (10μM) 0.8μl, PCR ReversePrimer (10μM) 0.8μl, Total RNA 2μl, RNase Free dH 2 O 4.8 μl, total volume 20...
Embodiment 3
[0060] Nanobody activity identification, including the following steps:
[0061] (1) Human serum albumin was diluted with coating solution and then coated with 100 ng / well of the microtiter plate, overnight at 4°C.
[0062] (2) Pour off the coating solution, wash the microplate with 200 μL PBS 5 times, and beat the plate on absorbent paper to ensure that the washing solution is completely drained.
[0063] (3) Add 200 μL of 5% skimmed milk powder to each well and block for 1 hour at room temperature.
[0064] (4) prepare nanobody dilution solution, concentration is from
[0065] (5) Wash the microtiter plate 5 times with 200 μL of PBS, add 100 μL of purified anti-human serum albumin nanobody, blank control, and positive control to each well, and incubate at room temperature for 2 hours.
[0066] (6) Wash the microtiter plate 5 times with 200 μL PBS, add 100 μL HRP-labeled antibody, and incubate at room temperature for 1 hour.
[0067] (7) Wash the microtiter plate 5 times w...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com