Neospora attenuated strain with double deletion of grx S16 and grx C5 genes and its construction method and application
A technology of Neospora and a construction method, which is applied in the field of genetic engineering to achieve the effects of reducing pathogenicity and preventing reinfection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1: Construction of Neospora Δgrx S16Δgrx C5 strain
[0033] (1) Basic strain Nc1: The Nc1 strain is an international standard strain with glutaredoxin S16 and glutaredoxin C5 genes, the nucleotide sequences of the glutaredoxin S16 and glutaredoxin C5 genes are sequentially are SEQ ID NO.1 and SEQ ID NO.2.
[0034] (2) Construction of pSAG1-Cas9-NcU6-sggrx S16 plasmid
[0035] The specific steps of pSAG1-Cas9-NcU6-sggrx S16 plasmid construction are as follows:
[0036] ①Using the EuPaGDT library in ToxoDB to design a target site for glutaredoxin S16 gene knockout, and design primers according to the target sequence to amplify the Cas9 fragment (fragment 1) and the Neospora U6 promoter (fragment 2). ), T carrier fragment (fragment No. 3), add grx S16-specific gRNA to the U6 promoter downstream primer and the upstream primer of the T carrier backbone, see the plasmid map figure 1 .
[0037] Fragment No. 1 primer (5'→3'):
[0038] F: ATACGACTCACTATAGGGGCG (SE...
Embodiment 2
[0151] Example 2: Characteristics of the Neospora Δgrx S16Δgrx C5 strain
[0152] (1) In vitro invasion and reproduction characteristics of Δgrx S16Δgrx C5 strain
[0153] Plaque assay can comprehensively reflect the invasion, proliferation and situation of Neospora, and the plaque area can directly reflect the invasion and reproduction ability of the parasite. HFFs cells were covered with 12-well cell culture plates, tachyzoites of Δgrx S16Δgrx C5 and Nc1 strains were collected, and then 300 tachyzoites were inoculated into HFF cells, cultured for 7 days, fixed in 4% paraformaldehyde at room temperature for 30 min, and washed with PBS , and stained with crystal violet. After 20 min of staining at room temperature, the residual crystal violet was washed away with PBS, and the plaque area was counted. The results showed that the plaque area of the Δgrx S16Δgrx C5 and Nc1 strains was significantly different (p>0.05), indicating that the invasion and proliferation ability of t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


