Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Neutralizing antigenic epitope fusion protein of three porcine diarrhea-causing viruses and construction method and application of neutralizing antigenic epitope fusion protein

A technology of antigenic epitopes and fusion proteins, applied in the field of genetic engineering, can solve problems such as virus contamination from foreign sources, and achieve strong immunogenicity

Active Publication Date: 2020-06-02
YANGZHOU UNIV
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the process of production, R&D and application of traditional vaccines may be accompanied by external virus contamination, and biosafety risks such as virus virulence returning to strength cannot be ignored.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Neutralizing antigenic epitope fusion protein of three porcine diarrhea-causing viruses and construction method and application of neutralizing antigenic epitope fusion protein
  • Neutralizing antigenic epitope fusion protein of three porcine diarrhea-causing viruses and construction method and application of neutralizing antigenic epitope fusion protein
  • Neutralizing antigenic epitope fusion protein of three porcine diarrhea-causing viruses and construction method and application of neutralizing antigenic epitope fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1.PEDV-COE, TGEV-SA, PoRV-VP7 neutralize the acquisition of epitope gene, utilize PCR method to design 3 pairs of primers as follows:

[0039] PEDV-COE-F: 5'-CGGGATCCTTCTAGAAACCTTCTGAGTC-3', (SEQ ID NO.3)

[0040] PEDV-COE-R: 5'-CGGAATTCATACTTGGTACACACAT-3', (SEQ ID NO.4)

[0041] TGEV-S-F:

[0042] 5'-CG GAATTC GGTTCTGGATCAGGAGGTTCTGGATCAGGATACACACATACCATT-3', (SEQ ID NO. 5)

[0043] TGEV-S-R: 5'-CCG CTCGAG TATAACAGCTGTGGCATCT-3', (SEQ ID NO. 6)

[0044] PoRV-VP7-F:

[0045] 5'-CCG CTCGAG GGTTCTGGATCAGGAGGTTCTGGATCAGGACCAAATGAAGCAGCTAC AG-3', (SEQ ID NO. 7)

[0046] PoRV-VP7-R: 5'-GG GGTACC GCAGCAGAATCTAAGG-3'; (SEQ ID NO.8)

[0047] With PEDV-HN13 strain (Zhao Zhenpeng. Epidemiological investigation of porcine epidemic diarrhea virus and preliminary establishment of rapid detection method [D]. Yangzhou University, 2016.), TGEV-TZ strain (Wang Xian. Porcine transmissible gastroenteritis Whole gene sequence analysis of virus TZ-10-2016 and establis...

Embodiment 2

[0048] Example 2. Construction and identification of recombinant pFastBacHT-COE-SA-VP7 eukaryotic expression vector

[0049] (1) Construction of recombinant pFastBacHT-COE-SA-VP7 eukaryotic expression vector

[0050] Take the correctly identified pGEM-T-COE, pGEM-T-SA, pGEM-T-VP7 and the expression vector pFast-Bac-HTA (purchased from Invitrogen), and inoculate them in 3 mL of Amp-containing (100 μL / mL) at a ratio of 1:100. ) in LB liquid medium, 37°C, 225rpm, cultured overnight. Take 2mL of each bacterial solution according to the instructions of the mini-extraction plasmid kit, and save the corresponding plasmids for later use, and then pGEM-T-VP7, pFast-Bac-HTA (see figure 1 ) were respectively digested with XhoI and KpnI, the target fragment was recovered by agarose gel electrophoresis, and the eukaryotic expression vector pFastBacHT-VP7 was obtained by T4DNA ligase connection; then pGEM-T-SA, pFastBacHT-VP7 (see figure 2 ) were respectively digested with EcoRI and Xho...

Embodiment 3

[0053] Example 3. Construction and identification of recombinant baculovirus rBacmid-COE-SA-VP7 shuttle vector

[0054] (1) Transposition of recombinant plasmid

[0055] Take 5 μL of pFastBacHT-COE-SA-VP7 plasmid DNA and add it to 100 μL of DH10Bac competent cells, and ice-bath for 30 minutes; heat shock at 42°C for 45 seconds, then immediately take out of the ice bath for 2 minutes; add 800 μL of SOC liquid medium, 37°C, Cultivate at 225rpm for 4 hours; then take out the cultured bacterial liquid, and use SOC liquid medium to dilute the culture into three concentrations successively, (200 μL bacterial culture and 800 μL SOC liquid medium): 10 -1 、10 -2 、10 -3 After dilution, centrifuge at 4500 rpm for 5 minutes, discard the supernatant, then add 200 μL SOC liquid medium to resuspend the bacterial pellet, spread it on the LA-BAC plate, and incubate it upside down in a 37°C incubator for 24-48h until colonies appear.

[0056] (2) Extraction of recombinant baculovirus shuttle...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a neutralizing antigenic epitope fusion protein reconstructed body of three porcine diarrhea-causing viruses, a preparation method and application of neutralizing antigenic epitope fusion protein. An amino acid sequence of the neutralizing antigenic epitope fusion protein of the three porcine diarrhea-causing viruses PEDV, TGEV, and PoRV is shown as SEQ ID NO.2. A gene sequence encoding the neutralizing antigenic epitope fusion protein is shown as SEQ ID NO.1. Main neutralizing antigenic epitope genes of PEDV, TGEV, and PoRV are selected correspondingly and spliced, and then tandem genes are subjected to fusion protein expression by a recombinant baculovirus eukaryotic expression system. Recombinant viruses expressing the tandem gene fusion proteins are used for immunizing mice through an intraperitoneal injection method, a body can be induced to generate an immune response, and the immunogenicity is high. A new method is provided for the prevention of PEDV, TGEV, and PoRV infection, and a foundation is further laid for the development of a novel vaccine for porcine diarrhea viruses.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a fusion protein of neutralizing antigenic epitopes of three porcine diarrhea-causing viruses, a construction method and application thereof. Background technique [0002] Porcine diarrhea caused by porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), and porcine rotavirus (PoRV) is an acute, highly contagious enteric disease that seriously endangers the pig industry. The onset of porcine diarrhea is characterized by severe enteritis, vomiting and watery diarrhea, especially high mortality in suckling piglets, which can cause significant economic losses and has become an important problem in the pig industry. Although a corresponding vaccine has been developed for it in recent years, the effect is not very satisfactory, and with the genetic mutation of the virus, the protective effect of the vaccine is becoming more and more un...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/866C12N7/01A61K39/295A61K39/215A61K39/225A61K39/15A61P31/14
CPCC07K14/005C12N15/86C12N7/00A61K39/12A61P31/14C07K2319/00C12N2720/12322C12N2720/12334C12N2770/20022C12N2770/20034C12N2710/14021C12N2710/14043A61K2039/70A61K2039/552Y02A50/30
Inventor 金文杰宁晨秦爱建邵红霞钱琨黄晓星王加圆王倩倩郑建高王建王姣邓建中王秋生洪枫
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com