Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of protein 14-3-3 h1 in TMV infected tobacco leaves

A technology of tobacco and protein, applied in the field of genetic engineering, can solve problems such as agricultural pollution, income loss of the state and laborers, restrictions on the use of chemical control drugs, etc.

Pending Publication Date: 2020-06-02
HENAN AGRICULTURAL UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, tobacco mosaic disease occurs to varying degrees in most parts of my country, causing huge income losses to the country and workers
At present, the control and prevention of viral diseases is a difficult problem that cannot be broken through. Although some breakthroughs have been made in the research of genetic engineering and chemical control, there are still certain bottlenecks in the application of production practice, especially chemical control. The resulting agricultural pollution has also limited the use of chemical control drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein 14-3-3 h1 in TMV infected tobacco leaves
  • Application of protein 14-3-3 h1 in TMV infected tobacco leaves
  • Application of protein 14-3-3 h1 in TMV infected tobacco leaves

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Cloning of 14-3-3 h1 gene

[0048] Using the total RNA extracted from tobacco leaves as a template to carry out reverse transcription experiments, according to the sequence of the coding region of tobacco 14-3-3 h1, design specific primers (the 5' and 3' ends of the primers were introduced into NdeI and SalI digestion enzymes respectively site) for RT-PCR amplification, and the target fragment of the 14-3-3 h1 gene was amplified with a high-fidelity enzyme, which was 777 bp. The 14-3-3 h1 gene amplified above was ligated to the PMD-19-T (simple) vector, and the ligated product was transformed into Escherichia coli DH5α competent cells. The 14-3-3 h1 gene sequence is shown in SEQ ID NO.1, and the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0049] 14-3-3-F: CCCATATGGGAGAAACATCAATGGCGTCG; SEQ ID NO. 2

[0050] 14-3-3-R: GCGTCGACTCAATCCTAAAGAAATGTCACC; SEQ ID NO.3

[0051] According to the prediction analysis of the online software Sopma, the 14-3-3 h1 protein co...

Embodiment 2

[0053] Subcellular localization of 14-3-3 H1 protein

[0054] In order to clarify the distribution of the 14-3-3 h1 protein in the cells, the vector was linearized with SpeI as the restriction site, and the PCR product was ligated at 37°C for 30 minutes. The ligated product was transformed into E. coli cells, and the resistance screening culture cultured overnight. The constructed 14-3-3-GFP fluorescent expression vector was transformed into Agrobacterium EHA105. The leaves of Nicotiana benthamiana were illuminated for 5 hours before the injection, so that the stomata of the leaves were fully opened to facilitate the injection. Gently scratch the epidermis with a sterile syringe needle to form the injection site. Use a 2mL sterile syringe to draw an appropriate amount of bacterial solution, put your left hand under the injection site, and gently push the syringe for injection. After the injected plants were cultured overnight in a dark environment, they were cultured normal...

Embodiment 3

[0059] Screening of interacting proteins of 14-3-3 h1 protein

[0060] The bait expression vector PGBKT7-14-3-3 was constructed and transformed into yeast AH109 competent cells, and the yeast AH109 cells that had been transferred to the recombinant plasmid PGBKT7-14-3-3 were fused with the tobacco cDNA library for fusion culture (30°C, 40rpm), After 20 hours, take a drop of bacterial liquid and observe it under a microscope, and you can observe the structure of clover in the field of view, such as image 3 ,Depend on image 3 It can be seen that the yeast AH109 cells have undergone fusion propagation. After continuing to cultivate for 4 hours, the bacteria were collected and resuspended with 0.5xYPDA liquid medium, then coated with SD / -His-Leu-Trp solid medium, and cultured at 30°C for 7 days. Pick well-formed colonies on the medium and dissolve them in 0.9% saline, pipette 1 μL on SD / –Ade–His–Leu–Trp+X-α-Gal solid medium and grow at 30°C for 2 days . Dissolve the blue col...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a coding gene 14-3-3 h1 of a tobacco protein 14-3-3 h1 in defense of TMV infected tobacco. The gene 14-3-3 h1 has a sequence shown in SEQ ID No. 1. The tobacco protein 14-3-3 h1 is applied to the defense of the TMV infected tobacco through inhibiting a vesicle transferring promoting function of a protein Arf to inhibit replication of TMV in cells. According tothe application, a detailed process for infecting tobacco by the TMV is researched from molecular biology and genetic engineering, a safe and effective infection prevention and control method is explored under the condition of being independent of chemical control drugs, and the aim of further carrying out early-stage warning and control on tobacco mosaic disease is achieved.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the application of tobacco 14-3-3 h1 protein and its coding gene in TMV-infected tobacco. Background technique [0002] 14-3-3 proteins are a family of highly conserved acidic proteins expressed in all eukaryotic cells, which function by binding to phosphorylated target proteins. The 14-3-3 protein plays an important role in the plant signal transmission network, not only can transmit the signal of the external environment, but also can cause a series of physiological responses by regulating the downstream proteins of the pathway. Plant 14-3-3 proteins, as regulators, participate in the processes of plant biotic and abiotic stress, primary metabolism and nutrient metabolism regulation, hormone signal transmission and light signal response. [0003] The diversity of the 14-3-3 protein determines its various ways of functioning. It can not only participate in the regulation of p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/82
CPCC07K14/415C12N15/8283
Inventor 王静郝风声徐良宋佳倩宋坤锋郭红祥石永春王潇然刘卫群
Owner HENAN AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com