Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Drug carrier, brain-targeted nanomedicine based on CRISPR gene editing technology and its preparation method and application

A nano-drug and gene editing technology, applied in drug combination, drug formulation, drug delivery, etc., can solve the problems of high recurrence rate, high mortality rate, low cure rate, etc., and achieve enhanced stability, good biocompatibility, The effect of high cutting efficiency

Active Publication Date: 2021-08-06
HENAN UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] 61.0%, with the characteristics of high incidence rate, high recurrence rate, high mortality rate and low cure rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drug carrier, brain-targeted nanomedicine based on CRISPR gene editing technology and its preparation method and application
  • Drug carrier, brain-targeted nanomedicine based on CRISPR gene editing technology and its preparation method and application
  • Drug carrier, brain-targeted nanomedicine based on CRISPR gene editing technology and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0048] The present invention provides a drug carrier, a brain-targeted nanomedicine based on CRISPR gene editing technology and its preparation method and application. Specifically, the present invention provides the following technical solutions.

[0049] The first aspect of the present invention provides a drug carrier, including polymer mPEG-P (GPMA, FPMA) and polymer Ang-PEG-PGPMA;

[0050] The structural formula of the mPEG-P (GPMA, FPMA) is:

[0051]

[0052] The structural formula of the polymer Ang-PEG-PGPMA is:

[0053]

[0054] Wherein, n is 35-45, x1 is 15-20, y is 2-4, m is 75-85, and x2=x1.

[0055] The Angiopep polypeptide in the drug carrier of the present invention helps to pass through the BBB and target to tumor cells, PEG can effectively prolong the blood circulation cycle and has good biocompatibility, and the guanidino Gu + It can not only combine with riboprotein complexes through electrostatic interaction but also form salt bridges and hydrogen b...

Embodiment 1

[0076] Preparation method of nano medicine

[0077] In this example, the nanomedicine is the nanoparticle Ang-NP@Cas9 / sgRNA, and the preparation method of the nanoparticle includes: transcribing sgRNA in vitro, synthesizing a polymer, and preparing nanoparticles. The target sequence of the transcribed sgRNA is TACCTACGGCAAATTGTGCT (SEQ ID NO: 1). Specific steps are as follows:

[0078] 1. In vitro transcription of sgRNA

[0079] In vitro transcription mimics the environment of in vivo transcription, and there is no RNase during the entire operation process. The purpose is to prevent the degradation of sgRNA after transcription. The samples should be divided and stored in a -80°C refrigerator. Specific steps are as follows:

[0080] 1.1 Annealed oligosaccharide oligo (total system 20μL)

[0081]

[0082] 95°C, after 5 minutes, leave it at room temperature overnight (or cool it down to room temperature naturally in boiling water).

[0083] 1.2 Add 1 μL of Taq enzyme (10X...

Embodiment 2

[0127] Nanomedicine Characterization Results

[0128] The particle size diagram of Ang-NP@Cas9 / sgPLK1 and Free Cas9 / sgPLK1 (i.e. Cas9 / sgPLK1 complex) is shown in figure 2 As shown in (a), the particle size and potential of the nanomedicine are shown in Table 1. figure 2 Middle (b) is the TEM image of Ang-NP@Cas9 / sgPLK1. The particle size of the Cas9 / sgPLK1 complex is about 30nm, with a negative charge. After being wrapped by a polymer, the particle size is 149nm, the stability is significantly enhanced, the uniformity is very good, and the surface has a weak positive charge. Treating tumors offers possibilities.

[0129] Table 1 The particle size and potential of nanomedicine

[0130]

[0131]

[0132] figure 2 Middle (c) is the detection result of circular dichroism spectrum. In this embodiment, BSA protein is taken as an example, using mPEG 2K -P(GPMA 4K ,FPMA 0.6K ) to prepare nanomedicine (NPs-BSA) by loading BSA protein, and compare the peak changes of Fre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a drug carrier, a brain-targeted nano drug based on CRISPR gene editing technology, a preparation method and application thereof. The nanomedicine provided in the present invention contains nanoparticles prepared by coupling Cas9 / sgRNA and a drug carrier, the Cas9 / sgRNA has high cutting efficiency, and the Angiopep polypeptide in the drug carrier helps to pass through the blood-brain barrier (BBB) ​​and target to Brain tumor cells, PEG can effectively prolong the blood circulation cycle and has good biocompatibility, guanidino Gu + It can not only combine with riboprotein complex through electrostatic interaction but also form salt bridge and hydrogen bond. A small amount of fluorine can enhance the stability of nanomedicine and greatly prolong the pharmacokinetic half-life of nanomedicine. Using the drug carrier can effectively transport the therapeutic drug to the lesion site. The nano-medicine can suppress and treat tumors at the gene level.

Description

technical field [0001] The invention relates to the field of nano-medicines, in particular to a drug carrier, a brain-targeted nano-medicine based on CRISPR gene editing technology, and a preparation method and application thereof. Background technique [0002] Glioma is a primary malignant brain tumor. Its incidence rate accounts for 35.2% of intracranial tumors. [0003] 61.0%, with high incidence, high recurrence rate, high mortality rate, low cure rate and other characteristics. The clinical methods currently used to treat glioma mainly include surgery, radiotherapy, chemotherapy and other methods. [0004] The blood brain barrier (BBB) ​​makes human glioma one of the most difficult tumors in cancer treatment. The BBB is a self-balancing defense mechanism for brain supplementation. On the one hand, it protects the central nervous system from foreign substances, maintains a high-efficiency homeostasis, and at the same time supplies nutrients to the brain; on the other ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K47/58A61K47/64A61K48/00A61P35/00C08F293/00C08F220/60C08F220/24
CPCA61K47/58A61K47/64A61K48/005A61P35/00C08F293/005C08F220/60C08F220/24C08F2438/03A61K38/465A61K31/7105A61K47/62A61K47/6933A61K47/6935C08G65/33337C08G2650/50C08G65/3348C08G65/337C12N9/22A61K47/549A61K47/60
Inventor 阮卫民焦明珠师冰洋郑蒙
Owner HENAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com