Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid ligand for soft-shelled turtle iridovirus, and construction method and application thereof

A nucleic acid aptamer and iridescent virus technology, applied in the field of bioengineering, can solve the problems of unsatisfactory rapid and accurate detection and diagnosis, expensive instruments and reagents, cumbersome operation, etc., and achieve convenient chemical synthesis in vitro, short preparation cycle, simple and rapid operation Effect

Active Publication Date: 2020-07-28
GUANGXI UNIVERSITY OF TECHNOLOGY +1
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The detection results of PCR technology are accurate and reliable, but there are disadvantages such as cumbersome operation, long time-consuming, expensive instruments and reagents, etc., which cannot meet the requirements of rapid and accurate detection and diagnosis on site

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid ligand for soft-shelled turtle iridovirus, and construction method and application thereof
  • Nucleic acid ligand for soft-shelled turtle iridovirus, and construction method and application thereof
  • Nucleic acid ligand for soft-shelled turtle iridovirus, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Screening and preparation of nucleic acid aptamers for detection of STIV

[0024] S1. Construction of the first ssDNA library and synthesis of primers

[0025] Design and synthesize the first ssDNA library Library 50, its nucleotide sequence is as follows:

[0026] 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC, wherein both ends are fixed sequences, and the middle 50 nucleotides are random sequences.

[0027] The upstream primer includes the DNA sequence shown in SEQ ID NO.3, and is labeled with hydroxyfluorescein (FAM), and its specific sequence is: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3'.

[0028] The downstream primer includes the DNA sequence shown in SEQ ID NO.4 and is labeled with Biotin, and its specific sequence is: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3'.

[0029] The first ssDNA library and primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0030] S2. SELEX screening to obtain nucleic acid aptamers that specifically recognize STIV...

Embodiment 2

[0049] 2.1 Main Instruments

[0050] Attune NxT flow cytometer (Thermo Fisher Scientific), FV3000 laser scanning confocal microscope (Olympus).

[0051] 2.2 Experimental group setting method

[0052] The nucleic acid aptamer of SEQ ID NO.1 and the nucleic acid aptamer of SEQ ID NO.2 constructed in Example 1 were respectively labeled with FAM.

[0053] Experimental group I: Dissolve 10 nmol of the nucleic acid aptamer of SEQ ID NO.1 in 500 μL of PBS, bathe in constant temperature water at 92°C for 5 minutes, then quickly insert it into ice, and bathe in ice for 10 minutes, and mix the treated first ssDNA library with STIV-infected fat The head carp cells were incubated on ice for 1 h, and after the incubation and binding were completed, the supernatant was removed by centrifugation.

[0054] Experiment Group II: Dissolve 10 nmol of the nucleic acid aptamer of SEQ ID NO.2 in 500 μL of PBS, bathe in constant temperature water at 92°C for 5 minutes, then quickly insert it into i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nucleic acid ligand for soft-shelled turtle iridovirus, and a construction method and application thereof. The nucleic acid ligand for the soft-shelled turtle iridovirus comprises a DNA sequence as shown in SEQ ID NO.1 and a derivative thereof. The nucleic acid ligand provided by the invention has relatively high affinity and specificity for the soft-shelled turtle iridovirus; and furthermore, the nucleic acid ligand also has the advantages of being free form immunogenicity, short in preparation period, good in reproducibility, small in molecular weight, convenient inin-vitro chemical synthesis, convenient to mark, easy to modify and substitute different parts of the nucleic acid ligand, steady in sequence, easy to transport and store, etc. When a rapid detectionmethod of the nucleic acid ligand in the invention is adopted for detecting the soft-shelled turtle iridovirus, operation is simple and rapid; the relatively high accuracy rate and sensitivity can beachieved; the nucleic acid ligand can be utilized for constructing a molecular probe or a detection kit; and furthermore, in combination with detection equipment, such as a microplate reader, a flow cytometry and a luorescence microscope, precise detection of the soft-shelled turtle iridovirus can be realized.

Description

[0001] This application is required to be submitted to the State Intellectual Property Office on February 07, 2020. The application number is CN202010082177.6, and the title of the invention is "a nucleic acid aptamer and its construction method and its application in the detection of Chinese soft-shelled turtle rainbow virus". The priority of the Chinese patent application, the entire content of which is incorporated in this application by reference. technical field [0002] The invention belongs to the technical field of bioengineering, in particular, it relates to a nucleic acid aptamer against Chinese soft-shelled turtle iridescent virus, its construction method and application. Background technique [0003] Soft-shelled turtles are rich in nutrition and have high medicinal value. As a large-scale and important aquaculture species in my country, the annual production of domestic soft-shelled turtles has reached more than 300,000 tons, and the direct output value of the in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115G01N33/569C12N15/10
CPCC12N15/115G01N33/56983C12N15/1093C12N2310/16
Inventor 李鹏飞余庆刘明珠程昊易弋肖贺贺吴思婷
Owner GUANGXI UNIVERSITY OF TECHNOLOGY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More