Unlock instant, AI-driven research and patent intelligence for your innovation.

Stably transferred cell strain for detecting NMO-IgG (neuromyelitis optica-immunoglobulin G) and construction method of stably transfected cell strain

A construction method and cell line technology, applied in the field of detection of NMO-IgG stably transfected cell lines and its construction, can solve the problems of short duration of exogenous gene expression

Inactive Publication Date: 2020-07-31
BEIJING HARMONY HEALTH MEDICAL DIAGNOSTICS CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this implementation has the disadvantage of short duration of exogenous gene expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Stably transferred cell strain for detecting NMO-IgG (neuromyelitis optica-immunoglobulin G) and construction method of stably transfected cell strain
  • Stably transferred cell strain for detecting NMO-IgG (neuromyelitis optica-immunoglobulin G) and construction method of stably transfected cell strain
  • Stably transferred cell strain for detecting NMO-IgG (neuromyelitis optica-immunoglobulin G) and construction method of stably transfected cell strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] The embodiment of the present invention provides a method for constructing a stable cell line for detecting NMO-IgG, which may include the following steps:

[0075] Step 1.1: Design primer pairs for amplifying the AQP4 M1 gene.

[0076] The DNA sequence and mRNA sequence of AQP4 M1 were searched through NCBI, and the upstream and downstream primers and restriction sites for PCR amplification were designed according to the AQP4 gene sequence. The designed primer pairs are shown in Table 1 below.

[0077] Table 1

[0078] Primer name Primer sequence 5'-3' AQP4 M1F ACACCTCGAGATGAGTGACAGACCCCACAG AQP4 M1R ACACTCTAGATCATACTGAAGACAATA

[0079] Step 1.2: Prepare the PCR amplification reaction system. The specific composition is shown in Table 2 below.

[0080] Table 2

[0081] PCR amplification reaction system volume / μl 10*PCR reaction buffer 5 2.0mM dNTPs 5 Mg 2+

1 Primer Mix (10μM) 1 DNA polymera...

Embodiment 2

[0123] The embodiment of the present invention provides the application of a stably transformed cell line in the detection of NMO-IgG in human serum.

[0124] Specifically, the following steps may be included:

[0125] Step 2.1: Routinely culture the stably transformed cell line in DMEM high-glucose medium containing 10% FBS, 37°C, 5% CO 2 cultured in an incubator.

[0126] Step 2.2: Take cells in good logarithmic phase and divide them into 5×10 5 cells / ml inoculated into a 48-well plate, placed at 37°C, 5% CO 2 Incubate overnight in an incubator.

[0127] Step 2.3: Discard the medium in the 48-well plate the next day, wash with PBS 3 times, and discard the PBS.

[0128] Step 2.4: Add 150 μl diluted goat serum to each well to block for 1 h.

[0129] Step 2.5: Discard goat serum, add 150 μl serum sample to each well, and incubate at room temperature for 1 hour.

[0130] Step 2.6: Discard the serum sample, wash 3 times with PBS, and discard the PBS.

[0131] Step 2.7: Add...

Embodiment 3

[0137] The embodiment of the present invention provides the application of stably transformed cell lines in screening or preparing anti-NMOSD drugs.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
volumeaaaaaaaaaa
Login to View More

Abstract

The invention provides a stably transferred cell strain for detecting NMO-IgG (neuromyelitis optica-immunoglobulin G) and a construction method of the stably transfected cell strain. The constructionmethod comprises steps as follows: an overexpression vector containing an AQP4 M1 gene is constructed, slow viruses are packaged in overexpression vector transfected cells, the slow viruses are concentrated and purified to transduce the cells, antibiotics corresponding to resistance of the vectors act on the transduced cells, and the stably transferred cell strain is obtained by screening. The exogenous genes are integrated to cell chromosomes, so that the constructed stably transferred cell strain can continuously and stably express AQP4 M1 protein for a long time, and the defect of short expression duration of the exogenous genes in instantaneous infection is overcome.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a stably transfected cell line for detecting NMO-IgG and a construction method thereof. Background technique [0002] Neuromyelitis optica (neuromyelitis optica, NMO) is an acute or subacute demyelinating disease in which the optic nerve and spinal cord are simultaneously and successively involved. It is an autoimmune disease that mainly involves the optic nerve and spinal cord. Failed to meet the diagnostic criteria for multiple sclerosis (MS). Multiple sclerosis is an autoimmune disease characterized by central nervous system white matter inflammatory demyelinating lesions, acquired chronic relapse or progression, and the pathological characteristic change is the formation of central nervous system demyelinating white matter plaques, lesions Mostly located around the lateral ventricles, the lesion often involves the trunk of the white matter, and the spinal cord a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/12C12N15/867C12N15/66C12N7/01C12Q1/02G01N33/68
CPCC07K14/47C12N7/00C12N15/66C12N15/86C12N2740/15021C12N2740/15043G01N33/5008G01N33/6854G01N2500/10
Inventor 贾玉霞智慧芳倪君君
Owner BEIJING HARMONY HEALTH MEDICAL DIAGNOSTICS CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More