Stably transferred cell strain for detecting NMO-IgG (neuromyelitis optica-immunoglobulin G) and construction method of stably transfected cell strain
A construction method and cell line technology, applied in the field of detection of NMO-IgG stably transfected cell lines and its construction, can solve the problems of short duration of exogenous gene expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0074] The embodiment of the present invention provides a method for constructing a stable cell line for detecting NMO-IgG, which may include the following steps:
[0075] Step 1.1: Design primer pairs for amplifying the AQP4 M1 gene.
[0076] The DNA sequence and mRNA sequence of AQP4 M1 were searched through NCBI, and the upstream and downstream primers and restriction sites for PCR amplification were designed according to the AQP4 gene sequence. The designed primer pairs are shown in Table 1 below.
[0077] Table 1
[0078] Primer name Primer sequence 5'-3' AQP4 M1F ACACCTCGAGATGAGTGACAGACCCCACAG AQP4 M1R ACACTCTAGATCATACTGAAGACAATA
[0079] Step 1.2: Prepare the PCR amplification reaction system. The specific composition is shown in Table 2 below.
[0080] Table 2
[0081] PCR amplification reaction system volume / μl 10*PCR reaction buffer 5 2.0mM dNTPs 5 Mg 2+
1 Primer Mix (10μM) 1 DNA polymera...
Embodiment 2
[0123] The embodiment of the present invention provides the application of a stably transformed cell line in the detection of NMO-IgG in human serum.
[0124] Specifically, the following steps may be included:
[0125] Step 2.1: Routinely culture the stably transformed cell line in DMEM high-glucose medium containing 10% FBS, 37°C, 5% CO 2 cultured in an incubator.
[0126] Step 2.2: Take cells in good logarithmic phase and divide them into 5×10 5 cells / ml inoculated into a 48-well plate, placed at 37°C, 5% CO 2 Incubate overnight in an incubator.
[0127] Step 2.3: Discard the medium in the 48-well plate the next day, wash with PBS 3 times, and discard the PBS.
[0128] Step 2.4: Add 150 μl diluted goat serum to each well to block for 1 h.
[0129] Step 2.5: Discard goat serum, add 150 μl serum sample to each well, and incubate at room temperature for 1 hour.
[0130] Step 2.6: Discard the serum sample, wash 3 times with PBS, and discard the PBS.
[0131] Step 2.7: Add...
Embodiment 3
[0137] The embodiment of the present invention provides the application of stably transformed cell lines in screening or preparing anti-NMOSD drugs.
PUM
| Property | Measurement | Unit |
|---|---|---|
| volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



