Specific DNA fragment ssm2 for sex identification of sturgeon and its application
A specific, DNA molecular technology, applied in the direction of DNA/RNA fragment, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem that the sex-specific DNA molecular marker of sturgeon is not detected, and increase the sex-specific correlation of sturgeon. Issues such as genetic or marker difficulty
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Obtaining the specific DNA fragment SSM2 for sex determination of sturgeon:
[0036] Using paraffin sections of gonad tissue to identify 20 male and female Sturgeon's sturgeons, extract their whole genome DNA, construct a sequencing library, and perform sequencing on the Illumina sequencing platform to obtain the whole genome sequencing data of male and female Sturgeon's sturgeons, which were obtained by comparative genomics analysis The female sex-specific DNA fragment, and corresponding primers were designed to verify its effectiveness in the population, and finally the female-specific DNA fragment SSM2 (shown in SEQ ID NO.1) was obtained, and no homologous sequence was found through GenBank database comparison.
Embodiment 2
[0038] The method of using the specific DNA fragment SSM2 for determining the sex of sturgeon:
[0039]1) Primers designed for the sequence shown in SEQ ID NO.1 are: F: ATACTATAACCCCTTTTACGC and R: TTCTTTTGGTTGCCCGAT.
[0040] 2) PCR amplification:
[0041] The reaction system is about 50ng of template DNA; 1.5U of Taq polymerase; 2.5μl of 10×amplification buffer; the concentration of four dNTPs is 200μM; the final concentration of upstream and downstream primers is 0.2μM; add ddH2O to 25μl.
[0042] The corresponding PCR reaction conditions were pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 25 s, and 35 cycles; final extension at 72°C for 7 min; storage at 4°C.
[0043] After PCR amplification, 2% agarose gel was prepared for electrophoresis detection. If the specific band was amplified, it was a female individual, and if no specific band was amplified, it was a male individual.
Embodiment 3
[0045] Application of specific DNA fragment SSM2 in sex identification of sturgeon:
[0046] 1) The fin ray tissue samples of 12 male and female individuals are known to be stored in absolute ethanol, and the genomic DNA is extracted by high-salt method, diluted to 50ng / μL and stored at -20°C for later use; the mentioned sturgeon is: Chinese Sturgeon, Acipenser dabryi, Acipenser schrenckii, Acipenser dabryi, Siberian sturgeon, Russian sturgeon, Acipenser schrenckii, Acipenser siberian (Acipenser ♀×Acipenser schrenckii), Acipenser dabryi (Acipenser dabryii ♀×Acipenser schrenckii ♂).
[0047] 2) Utilize the method for embodiment 2 to carry out PCR amplification to above-mentioned sturgeon DNA sample;
[0048] 3) The amplification results are as follows:
[0049] figure 1 Shows the amplification results of Sturgeon's sturgeon; in the figure 1-12, the male individuals cannot amplify the band, 13-24, the female individuals can amplify the 264bp specific band, C indicates the nega...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


