Antibody and preparation method and application thereof

A technology of antibody and antibody library, applied in the field of biomedicine, can solve the problems of difficulty in producing high-titer high-affinity antibodies, weak immunogenicity, etc., and achieve the effect of high affinity, strong stability, and easy modification

Active Publication Date: 2020-08-07
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because AFB1 is a small molecular compound, when preparing traditional antibody IgG, its immunogenicity is weak, and it is difficult to produce high-titer high-affinity antibodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibody and preparation method and application thereof
  • Antibody and preparation method and application thereof
  • Antibody and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Example 1 Construction of phage display lamprey-derived antibody primary library against AFB1

[0074] 1. RNA extraction and cDNA synthesis

[0075] Dock the tail of lamprey immunized with complete antigen AFB1-HEL (serum titer 1:16000) to take blood, and ELISA method to detect lamprey anti-AFB1-HEL serum titer results see figure 1 , lymphocytes were isolated, the total RNA of lymphocytes was lysed and extracted with Trizol, and the first strand of cDNA was synthesized using a reverse transcription kit.

[0076] 2. Amplification of the VLR gene

[0077] 1. Primer design:

[0078] Primer F (including Nco I restriction site) SEQ ID NO.5: CATGCCATGGGTTGGATCAAGTGGATCGCCACG

[0079] Primer R (including Not I restriction site) SEQ ID NO.6: ATAAGAATGCGGCCGCACGTTTCTTGCAGAGGGCG

[0080] 2. PCR amplification system of VLR gene fragments:

[0081] Lamprey leukocyte cDNA was used as a template and amplified with Pyrobest DNA polymerase. The PCR amplification system is shown in...

Embodiment 2

[0086] Construction and panning of the phage antibody library of embodiment 2

[0087] 1. Connection between VLR and pCANTAB-5E

[0088] Follow the steps in Table 2 below:

[0089] Table 2

[0090]

[0091]

[0092] Ligate at 16°C for 12-16 hours, and extinguish T4 ligase at 70°C for 10 minutes.

[0093] 2. Construction of VLR library - electrotransformation of recombinant plasmid pCANTAB 5E-VLR

[0094] 1) Melt the recombinant plasmid pCANTAB 5E-VLR and electroporation competent TG1 on ice, and put the electroporation cup on ice to pre-cool;

[0095] 2) Take 4 μL of the recombinant plasmid pCANTAB 5E-VLR and add it to the melted competent TG1, and gently pipette to mix;

[0096] 3) Add the competent cells mixed with the recombinant plasmid into the pre-cooled 0.1cm electroporation cup, cover the lid, and gently tap the bottom of the cup on the table, so that the competent cells are evenly distributed on the bottom of the cup, and at the same time exclude Bubbles, q...

Embodiment 3

[0134] Example 3 Detection of positive phage single-chain antibody function

[0135] 1. Phage ELISA detection of positive clones

[0136] The present invention randomly picks 94 single clones from the 10cm plate whose titer is measured after the fifth round of screening, infects with helper phage, displays VLR on the capsid protein of the phage, and then coats the microtiter plate with AFB1-BSA , carry out phage ELISA to screen anti-AFB1 recombinant phage; the last two wells (95, 96) use helper phage as negative control wells, and the OD450 is 0.046 and 0.047 respectively. From the results of ELISA, it can be seen that there are many clones with higher affinity in the 94 clones. clone (results see Figure 5 );

[0137] 1) Mix 40 μg of protein antigen AFB1-BSA in 20 mL of PBS and coat a 94-well microtiter plate.

[0138] Well 100μL, put in 4 ℃ refrigerator overnight, you can also use carbonate buffer;

[0139] 2) Discard the antigen coating solution, and wash 3 times with t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an antibody as well as a preparation method and the application thereof. According to the method, AFB1-BSA is used as an elutriating antigen to coat an immune tube; using phagedisplay techniques, according to the present invention, the high affinity bacteriophage is elutriated from the antibody library constructed by using AFB1-HEL as the immunogen to immunize lamprey so asto obtain the two anti-AFB1 lamprey-derived novel antibody molecules, such that the solid foundation is provided for the detection and the research of AFB1, and the broad application prospect and thehuge market value are provided.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to an antibody and its preparation method and application. Background technique [0002] Aflatoxins (AFT) are a group of highly toxic secondary metabolites mainly produced by the fungus Aspergillus flavus or Aspergillus parasiticus, widely present in peanuts, corn and other common crops and feedstuffs. Among mycotoxins, aflatoxin B1 (AFB1) is known to be the most toxic carcinogen and is closely related to human liver cancer and other cancers. The toxicity of AFB1 is 10 times that of potassium cyanide and 68 times that of arsenic, and can cause acute poisoning death in humans. In 1993, AFB1 was classified as a class I carcinogen by the International Agency for Research on Cancer. [0003] There are many detection methods for aflatoxin, from the initial thin-layer chromatography (TLC), to high-performance liquid chromatography (HPLC), liquid chromatography-mass chromatography (LC-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/14C12N15/13G01N33/53
CPCC07K16/14G01N33/5308
Inventor李尹雄王宁庄苑琦袁方
OwnerGUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI