Check patentability & draft patents in minutes with Patsnap Eureka AI!

Pig SOX10 mutant gene causing inner ear hypoplasia and application of pig SOX10 mutant gene

A technology of inner ear hypoplasia and SOX10, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of long breeding period, unfavorable scientific research, etc., and achieve the effect of high accuracy

Pending Publication Date: 2020-08-07
ARMY MEDICAL UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Large animals such as cattle are not conducive to scientific research due to their long breeding period and the limitation of cloning technology.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig SOX10 mutant gene causing inner ear hypoplasia and application of pig SOX10 mutant gene
  • Pig SOX10 mutant gene causing inner ear hypoplasia and application of pig SOX10 mutant gene
  • Pig SOX10 mutant gene causing inner ear hypoplasia and application of pig SOX10 mutant gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Discovery and determination of mutation site of SOX10 c.321dupC

[0030] In the process of studying the mutation efficiency of homologous recombination caused by the Cas9 gene editing system, a series of mutant individuals were obtained, such as figure 1 shown. For details, please refer to the reference "Zhou, X., et al. (2016). Efficient Generation of Gene-Modified Pigs Harboring Precise Orthologous Human Mutation via CRISPR / Cas9-Induced Homology-Directed Repair in Zygotes. Hum Mutat 37(1): 110 -118)".

[0031]By analyzing and comparing the changes in the SOX10 protein coding sequence caused by the mutant sequences of the above-mentioned mutant individuals, the impact on the genome, and comparing the phenotype and genetic analysis of the point mutation SOX10 (c.325A>T) individuals among the obtained mutant individuals, it was found that c The .321dupC mutation can cause frameshift changes in SOX10 protein and prematurely terminate protein translation. At the same ti...

Embodiment 2

[0033] Preparation of SOX10 c.321dupC Single Base Duplication Mutation Genetic Engineering Miniature Pigs

[0034] Through the efficient genetic modification mediated by the CRISPR / Cas9 system, the SOX10 c.321dupC mutation site was targeted and introduced into the corresponding sequence of the normal pig SOX10 gene (SEQ ID NO: 1), and the positive pigs showed hypoplasia of the inner ear and showed dominant inheritance.

[0035] 1. sgRNA site selection (sgSOX10-exon2):

[0036] Sequence: 5'-agagcaaaccgcacgtcaag agg -3' (SEQ ID NO: 2), the sense strand located in the second exon of the porcine SOX10 gene, where the underlined bold part is the PAM structure.

[0037] 2. Design of single-stranded oligonucleotide DNA (pSOX10-321dupC-ssODN) as a homologous recombination template:

[0038] The sequence is as follows: 5'-tggaccctggtgcccatgcccgtgcgcgtcaacggcgccagcaagagcaaaccgcacgtc C aagaggcccatgaacgccttcatggtgtgggcgcaggcggcgcgcaggaagctggccgac-3' (SEQ ID NO: 3); the underlined bold...

Embodiment 3

[0080] SOX10 c.321dupC single-base duplication mutation genetic engineering miniature pig mutation detection

[0081] Exon 2 of SOX10 gene was amplified by PCR and sequenced. The results showed that all albino individuals had a single-base duplication mutation in exon 2 (c.321dupC, p.K108QfsX44), that is, a duplication of cytosine C at position 321 of the cDNA resulted in a frameshift mutation in the SOX10 protein and an early Terminate translation. The specific experimental method is as follows:

[0082] 1) Using Tiangen DNA Extraction Kit (#DP304, Tiangen), according to the method in the kit manual, extract DNA from the ear tissue of 5 F-generation individuals and measure its concentration, and store it at -20°C for later use;

[0083] 2) Using DNA as a template and using specific primers for porcine SOX10 gene (SEQ ID NO: 2-5), perform PCR according to the following reaction system and procedure to obtain an amplified product. Due to the high GC content of the SOX10 gene, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a pig SOX10 mutant gene causing inner ear hypoplasia and an application of the pig SOX10 mutant gene. The pig SOX10 mutant gene is characterized in that the 321st basic groupcytosine C of an SOX10 gene coding region is subjected to replication (SOX10 c.321 dupC), the mutation can cause infertility of the inner ear and is autosomal dominant inheritance, and can be used forpathogenesis, prevention, diagnosis and treatment research of infertility of the inner ear of a human body. The pig SOX10 mutant gene can be used for preparation of a disease animal model with incomplete development of the inner ear. The model can be used for research on pathogenesis, prevention, diagnosis and treatment on human inner ear hypoplasia, and is of great significance to research on inner ear hypoplasia.

Description

technical field [0001] The invention belongs to the technical field of biological gene detection, and in particular relates to a pig SOX10 mutation gene causing inner ear hypoplasia, and also relates to the application of the gene. Background technique [0002] SOX10 [sex determining region box gene, SRY (sex determining region Y)-box 10] is located in the human chromosome 22q13.1 region, the cDNA is 1.4kb in length, and contains 5 exons, of which exons 3, 4, and 5 The encoded protein contains 466 amino acids. It has highly conserved sequences among different species. Participate in the transcriptional regulation of target genes in the form of monomers or dimers, and affect the development of neural crest and inner ear. The SOX10 gene is expressed in the early embryonic development of the human inner ear, and is mainly expressed in melanocytes derived from the neural crest in the adult inner ear. It is a key transcription factor in the development of the inner ear. The en...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/47C12N15/85C12N5/10C12Q1/6883A01K67/027
CPCC07K14/47C12Q1/6883C12N15/85A01K67/0275C12Q2600/156A01K2217/056A01K2227/108A01K2267/0306
Inventor 林婷婷王勇刘传宏罗力华郭维维任巍
Owner ARMY MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More