[0045] Example 2
[0046] The preparation method of the above kit includes the following steps: Spread the PVC bottom plate 1 with NC film on the work surface, stick the binding pad 4, sample pad 5 and absorbent pad 2 respectively, and cut into 4.0mm wide strips with a strip cutter. Test strips: Put each test strip into a plastic card case, put each reagent card in an aluminum film bag, add 1 pack of 1g desiccant, heat seal and seal, which is an immunofluorescence chromatography test card.
[0047] Specifically:
[0048] 1) The coating film is made by the following method:
[0049] Dilute the CD2v protein and IgY with 3% sucrose-containing PB (0.01M PH7.4) to a concentration of 1mg/ml as the detection line and quality control line solution, draw a line on the nitrocellulose membrane, and use a marker on one end of the membrane Mark the quality control line and the test line. The distance between the quality control line and the test line is 5mm, the distance between the T line and the lower edge of the nitrocellulose membrane is 10mm, and the scribing concentration is 1μL/cm.
[0050] After completion, place the sheet in a drying room with temperature (18~26)℃ and humidity ≤30% to dry overnight (16~18)h. After drying, quickly put it into aluminum film bag, add desiccant, and seal, (2 ~8) Store at ℃ for later use.
[0051] 2) The bonding pad is made by the following method:
[0052] Disperse 1mg nano-rare-earth fluorescent microspheres ultrasonically, dilute 10 times with activation buffer MES, and add them to a 2ml EP tube; add 10mg of activator EDC and 10mg of activator NHS, mix well, and activate for 15min-30min; 14000r/ Centrifuge for 15 minutes; discard the supernatant, add 1ml of coupling buffer, and then disperse uniformly with ultrasound, add 100μg of CD2v protein or goat anti-chicken IgY dropwise while stirring, mix at room temperature for 1 hour, add blocking agent to block for 1 hour , 14000r/min, centrifuge for 15min, remove the supernatant, add the reconstituted solution to disperse evenly, that is, the marked T line and C line markers.
[0053] Cut the glass fiber membrane into a size of 10mm*300mm, mix the marked T-line and C-line markers according to the ratio of 1:10 (V:V), and spray it with a gold-spraying scoring machine at 3μl/cm and 0.02MPa After cutting the 8964, place it in a drying room with temperature (18~26)℃ and humidity ≤30% to dry overnight (16~18)h. After drying, quickly put it into aluminum film bag, add desiccant, and seal. (2~8) Store at ℃ for later use.
[0054] 3) The sample pad is made by the following method:
[0055] Prepare Tris (0.01M PH8.0) sample pad working solution containing 1% S9, 0.5% Triton and 0.05% sodium azide; feed 40ml/sheet of RB65 glass fiber, spread each sheet evenly with a roller, and dry at 37°C After 24h, cut it into a size of 23mm*300mm with a cutter, put it into an aluminum film bag, add a desiccant, and seal it for later use.
[0056] 4) Preparation of absorbent pad
[0057] Cut absorbent paper into 25mm*300mm size, set aside.
[0058] 5) Configuration of serum diluent
[0059] 0.01M pH7.4 phosphate buffer containing 0.8% S21, 0.03% Proclin300
[0060] 6) The above antigen preparation method:
[0061] 6.1) Expression of African swine fever CD2v protein
[0062] Artificially synthesized according to the nucleotide sequence of ASFV (GenBank: MK333181.1) CD2v gene in GenBank, and designed and synthesized a pair of primers. The CD2v gene fragment was amplified from ASFV DNA by PCR and cloned into the expression vector pIRES-EGFP (Purchased from American Clontech company), constructed the recombinant plasmid pIRES-CD2v, after sequencing verification, the recombinant plasmid was extracted and transfected into CHO-K1 cells (purchased from the cell bank of the Type Culture Collection Committee of the Chinese Academy of Sciences), with 6μg/mL purine The cell culture medium of mycin was screened under pressure. After 2 weeks, a small amount of nucleic acid was extracted from the cell clone for PCR identification. The correct cell clone was identified and then 2-3 rounds of single cell cloning were performed to obtain a cell line stably expressing the CD2v gene and named CHO -CD2v cell line.
[0063] The designed primers are:
[0064] CD2v-F 5'-GAC GCGGCCGC ATGATATACTTATTTTTTTAATA-3'((SEQID NO.1)
[0065] CD2v-R 5'-GTCGGATCC TTA GTGGTGGTGGTGGTGGTGGGGAAATG GGTTGAGTGGTTGT-3' (SEQID NO. 2);
[0066] The underlined part is the introduced restriction site, CD2v-F is the upstream amplification primer of ASFV CD2v gene, and the introduced restriction site is Not I; CD2v-R is the downstream amplification primer of ASFV CD2v gene, the introduced restriction site It is BamH I. At the same time, 6 histidine coding bases are introduced in the downstream primer for the purification of CD2v expression protein. The CACCAC CACCACCACCAC (SEQID NO.3), CD2v gene sequence and primers are all from Shenggong Bioengineering (Shanghai) Co., Ltd. synthesis.
[0067] 6.2) Purification of African swine fever CD2v protein
[0068] CHO-CD2v cell line at 37℃, 5% CO 2 Large-scale suspension culture in the incubator for 3 days, centrifugation to collect the cells, discard the supernatant, wash the resuspended cells with PBS, ultrasonic lysis (ultrasound 5s, 5s interval, 10min total), centrifuge at 12000rpm, collect the supernatant, and perform SDS-PAGE analysis. A nickel ion affinity chromatography column was used for protein purification. After purification, it was identified by SDS-PAGE and western blotting, and a single band was obtained with good antigenicity. The BCA method was used to determine the protein content after purification. The standard concentration and the corresponding OD value are shown in Table 1. The OD value of the purified CD2v protein was 1.917, and its concentration was 1.5 mg/ml after comparing with the standard product.
[0069] Table 1
[0070]
[0071] 7) Preparation of standard ASFV positive serum and standard ASFV negative serum
[0072] During the establishment of the immunofluorescence chromatography detection method, the negative and positive standard serum was prepared in order to establish the validity verification of the kit, the negative and positive judgment standards and to avoid human operation errors. The present invention has developed a standard ASFV antibody positive control serum and a standard ASFV antibody negative control serum, which are used for optimization of experimental conditions and determination of detection results.
[0073] 7.1) Preparation of standard positive serum
[0074] Take New Zealand white rabbits (purchased from Guangdong Experimental Animal Center), weighing 2-3 kg. For the first immunization, use a syringe to draw 1 ml of an emulsion of Freund's complete adjuvant (FCA) (purchased from Sigma, USA) and recombinant CD2v protein in equal proportions, and inject 0.5 ml into the muscle of the inner thigh. After an interval of 2 weeks, a second immunization was carried out. The same dose and site injection of Freund's incomplete adjuvant (purchased from Sigma in the United States) and recombinant CD2v protein in an equal proportion of emulsion 1ml, an interval of 7-10 days, from the ear vein Take 0.5-1.0ml blood, separate the serum, and detect the serum titer by enzyme-linked immunosorbent method. The antibody titer can reach more than 1:10000.
[0075] Blood was collected by cardiac blood collection method, separated after the serum was separated, centrifuged at 3000 r/min for 15 minutes, the supernatant was taken, and thimerosal was added with a final concentration of 0.01% as preservative, and after packaging, stored at -20°C.
[0076] 7.2) Preparation of standard negative serum
[0077] A clean laboratory pig (purchased from the Experimental Animal Center of Southern Medical University) was used as a pig for blood collection. The blood collection precursor was in good condition, with normal body temperature, appetite, and urine, and was not immunized with any vaccine or other diseases. After disinfection, blood is collected from the anterior vena cava, the serum is separated, and 1/10,000 thimerosal is added for preservative. Dispense 0.5ml into sterile tubes and store at -20°C.
[0078] In order to better understand the present invention, the detection principle of the kit of the present invention
[0079] Using the double antigen sandwich method, the sample is dropped into the sample hole of the reagent, and the chromatography is performed under capillary effect. The ASFV-Ab in the sample binds to the fluorescently labeled CD2v protein on the binding pad, diffuses to the test area, and is coated in The CD2v protein of the nitrocellulose membrane is captured and forms a complex to gather in the test area; the fluorescence intensity of the test area is proportional to the concentration of virus antibody in the sample, and the fluorescence signal value is converted into the sample by the immunochromatographic quantitative analyzer according to the calibration curve Middle antibody concentration; C line is the quality control line, and the reagent is proved to be effective after the fluorescence intensity reaches the set effective value.
