Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Donkey-derived bacillus pumilus and application thereof to preparation of medicine for treating diarrhea of donkey foals

A Bacillus pumilus, donkey-derived technology, applied in the application field of medicine, can solve the problem of not growing Bacillus pumilus

Active Publication Date: 2020-08-18
VEGETABLE RES INST OF SHANDONG ACADEMY OF AGRI SCI +2
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no medium that can grow Lactobacillus plantarum without growing Bacillus pumilus under normal conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Donkey-derived bacillus pumilus and application thereof to preparation of medicine for treating diarrhea of donkey foals
  • Donkey-derived bacillus pumilus and application thereof to preparation of medicine for treating diarrhea of donkey foals
  • Donkey-derived bacillus pumilus and application thereof to preparation of medicine for treating diarrhea of donkey foals

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Isolation of Bacillus pumilus from Donkey

[0023] Freshly formed droppings from healthy donkeys were taken. In the ultra-clean workbench, use a red-hot scalpel to burn the surface of the feces for 2-3 times, cut a small opening, insert a sterile inoculation loop into the feces, inoculate it on ordinary nutrient agar medium, and incubate at 37°C for 48 hours . Pick a single colony with white folds on the surface, streak inoculate, and purify 2-3 times. Microscopic examination showed no miscellaneous bacteria, and samples were sent for bacterial identification.

Embodiment 2

[0025] Identification results of Bacillus pumilus

[0026] (1) Colony characteristics: The colonies of Bacillus pumilus are medium in size, white waxy, with irregular edges, dry, and wrinkled. Microscopic features of bacteria: thin rod-shaped bacteria, lateral flagella, endospores, Gram-positive. See figure 1 .

[0027] (2) Physiological and biochemical experiments

[0028] Table 1 Biochemical identification results of Bacillus pumilus

[0029]

[0030] (3) 16S rRNA identification results

[0031] The 16S rRNA partial sequence of the strain was amplified with universal primers 7F and 1540R, and then sent to Beijing Qingke Xinye Biotechnology Co., Ltd. for sequencing to obtain a gene sequence with a length of 1426bp:

[0032]CTTCCCCCAATCATCTGCCCACCTTCGGCGGCTGGCTCCATAAAGGTTACCTCACCGACT TCGGGTGTTGCAAACTCTCGTGGTGTGACGGGCGGTGTGTACAAGGCCCGGGAACGTAT TCACCGCGGCATGCTGATCCGCGATTACTAGCGATTCCAGCTTCACGCAGTCGAGTTGCA GACTGCGATCCGAACTGAGAACAGATTTGTGGGATTGGCTAAACCTTGCGGTCTCGCAG CCCTTTG...

Embodiment 3

[0033] The enzyme-producing ability of embodiment 3 bacillus pumilus

[0034] Add 1% casein, 1% sodium carboxymethylcellulose, and 1% soluble starch to the commercially available common nutrient agar medium to prepare three kinds of medium for screening the protease and cellulase production of Bacillus pumilus , Producing amylase performance. Observation by cultivation, found that Bacillus pumilus produced protease, but not cellulase and amylase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly relates to donkey-derived bacillus pumilus and application of the donkey-derived bacillus pumilus to preparation of a medicinefor treating diarrhea of donkey foals. The invention provides bacillus pumilus separated from excrement of healthy donkeys, which is further determined by combining 16s rDNA with physiological and biochemical identification, and the bacillus pumilus is named as bacillus pumilus; the research shows that the bacillus pumilus has a very good effect of preventing or treating the diarrhea of the donkey foals. Finally, bacillus pumilus (CGMCC No: 18026) is combined with commercially available lactobacillus plantarum, citric acid, isomaltooligosacharide and glucose to prepare the complex microbial inoculant for treating diarrhea of donkey foals, and the effect is remarkable.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a strain of bacillus pumilus derived from donkey and its application in the preparation of medicine for treating donkey foal diarrhea. Background technique [0002] Donkey foal diarrhea is a common disease, mostly in donkey foals aged 1 to 2 months, mainly manifested as watery diarrhea, dehydration and other symptoms, which can be caused by pathogenic bacteria, viruses, nutritional deficiencies, indigestion and other reasons sick. Escherichia coli diarrhea and diarrhea caused by feeding stress in donkey foals are relatively common. Sensitive antibiotic treatment is effective for E. coli diarrhea but not for feeding stress diarrhea, and antibiotics have the potential risk of leading to bacterial resistance. There are also methods to prevent the disease with bacterial vaccines, but there are many serotypes of Escherichia coli, and the effect of bacterial vaccines is diffic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A61K35/742A61K35/747A61K31/702A61K31/7004A61P1/12C12R1/07
CPCC12N1/20A61K35/742A61K35/747A61K31/702A61K31/7004A61P1/12C12R2001/07C12N1/205A61K2300/00
Inventor 张燕张伟黄迪海郭卉齐鹏飞
Owner VEGETABLE RES INST OF SHANDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com