Check patentability & draft patents in minutes with Patsnap Eureka AI!

A kind of polyclonal antibody of rice stripe virus nucleocapsid protein and its preparation method and application

A rice streak virus, nucleocapsid protein technology, applied in antiviral immunoglobulin, virus/phage, microorganism-based methods, etc. stability and other issues to achieve the effect of facilitating disease monitoring

Active Publication Date: 2021-09-24
YANGZHOU UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the commonly used detection methods for rice stripe leaf blight virus in SBPH at home and abroad include RT-PCR, Northern, DIBA and ELISA, etc. RT-PCR and Northern have high cost and equipment requirements, and are not suitable for batch operation
The virus monoclonal antibody developed by Zhou Yijun's team can be used for DIBA and ELISA detection. Its simplicity and speed are suitable for grassroots agricultural technicians. However, the monoclonal antibody is unstable in WB, IF and IM detection, and cannot meet the expectations of scientific researchers Experimental requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of polyclonal antibody of rice stripe virus nucleocapsid protein and its preparation method and application
  • A kind of polyclonal antibody of rice stripe virus nucleocapsid protein and its preparation method and application
  • A kind of polyclonal antibody of rice stripe virus nucleocapsid protein and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0028] In the present invention, the preferred method for preparing the recombinant vector comprises the following steps: 1. Total RNA planthopper) Rice stripe virus extracted with reverse transcription to obtain cDNA; 2) to said cDNA as a template for PCR amplification by obtaining the gene fragment encoding the CP; 3) to obtain the transformed E. coli CP / pMD-19T connects the plasmids and gene fragments pMD-19T vector; 4) the CP / pMD-19T double-digested plasmid recovered CP gene fragment encoding the vector pET-28a is connected to the obtained recombinant vector.

[0029] In the present invention, total RNA was extracted with planthopper rice stripe virus, reverse transcription to obtain cDNA. In the present invention, the total RNA was extracted using TRIzol preferred method, in a particular embodiment of the process of the present invention, preferably performed using a kit, said kit preferably TRIzol TM LS Reagent, 10296010, ThermoFisher, USA; see specific steps to kit inst...

Embodiment 1

[0046] Construction of CP / PET-28A prokaryotic expression vector:

[0047] Sequence amplification of rice striped virus CP: Trizol Method (Trizol TM LS Reagent, 10296010, Thermofisher, USA) Extract the total RNA of poisonous gray-prolad trend; to extract the total RNA for the template to reverse the cDNA; reverse transcription adopts TAKARA anti-transcription kit, operation See Kit Manual .

[0048] PCR amplification was performed by cDNA to obtain a CP gene.

[0049] Special primers in PCR amplification:

[0050] CP-BAMHI-R: taggatccctagtcatctgc (SEQ ID No.3);

[0051] CP-NOCI-F: taccatgatgtgggctatgt (SEQ ID No.4).

[0052] The PCR amplification system is shown in Table 1.

[0053] Table 1 PCR amplification system

[0054]

[0055] PCR amplification procedure:

[0056] (1) Pre-deformation of 94 ° C for 3 min;

[0057] (2) 94 ° C denaturation 30s, 56 ° C annealing 30s, 72 ° C extension 1min, 45 cycles;

[0058] (3) Extension at 72 ° C for 10 min.

[0059] The PCR product was co...

Embodiment 2

[0064] CP / pET-28a plasmid construct: Solution I is connected with the CP pMD-19T vector fragment recovered in Example 1 molar ratio of enzyme to embodiment 3: 1,16 ℃, 30min connection. The ligation product was transformed into E. coli by heat shock method, using a sieve resistance and positive colonies were blue-white screening. After sequencing at -20 ℃ CP / pMD-19T plasmid.

[0065] (15U / μl) and NcoI (15U / μl) enzyme double digestion method CP / pMD-19T BamHI digested according to the respective plus 1μl 50μl system, the fragment Gel Extraction according to the vector pET-28a 3: 1,16 ℃, 30min connection. Transformation of E. coli positive clones and sequencing, is obtained CP / pET-28a prokaryotic expression vector.

[0066] CP fusion protein prokaryotic expression:

[0067] (1) CP / pET-28a transformed E. coli culture: The recombinant plasmid CP / pET-28a Rosetta transformed into E. coli competent cells, 37 ℃, 220rpm overnight. 1: 100 dilution into the culture medium Kanam...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing a polyclonal antibody to rice stripe virus nucleocapsid protein and its application, and belongs to the technical field of rice stripe virus detection. The polyclonal antibody to rice stripe virus nucleocapsid protein CP is based on rice stripe virus The nucleocapsid protein CP is obtained by immunizing animals with an immunogen; the amino acid sequence of the rice stripe virus nucleocapsid protein CP is shown in SEQ ID No.1. The polyclonal antibody of the rice stripe virus nucleocapsid protein of the present invention has the characteristics of low cost, wide application, multiple audiences, high sensitivity, etc., and can be used in immunospot assay, enzyme-linked immunosorbent assay, western blot, immuno A number of biological detection experiments such as fluorescence method and immunoelectron microscope method. Using the polyclonal antibody of the present invention, the early warning of the disease is carried out by the striatellus striatellus at the beginning of the outbreak of the rice stripe leaf blight, which is beneficial to the multi-means disease monitoring.

Description

Technical field [0001] The present invention belongs to the technical field of detection Rice stripe virus, in particular, it relates to polyclonal antibodies of a Rice stripe virus nucleocapsid protein and its preparation method and application. Background technique [0002] Rice stripe virus (Rice stripe virus, RSV) virus belonging to the genus slim. Rice stripe virus caused by rice stripe virus on rice East Asia temperate, subtropical serious disease. The disease was first discovered in 1987 in Japan, Tochigi, Gunma, passed after North Korea, Russia, Ukraine and China. my country since 1963 originated in Jiangsu and Zhejiang provinces, spread to Shanghai, Fujian, Shandong, Jiangxi, Anhui, Hubei, Guangxi, Guangdong, Hebei, Henan, Liaoning, Yunnan, Taiwan and other 16 provinces, municipalities and autonomous regions. Since 2000, the incidence common in northern Jiangsu, northern Zhejiang, Yunnan Baoshan Chuxiong, Beijing Double Bridge, Yuanyang, Henan, Shandong Jining other regi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/08C07K16/10C07K16/06C12N15/40C12N15/70C12N1/21G01N33/569C12R1/19
CPCC07K14/005C07K16/065C07K16/10C07K2317/20C12N15/70C12N2760/00022G01N33/56983G01N2469/10
Inventor 李尧陈丹玉刘芳
Owner YANGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More