Method for improving expression level of human coagulation factor IX

A technology of human blood coagulation factor and expression level, applied in the field of biochemistry, can solve the problems of large economic burden, high treatment cost, iron element accumulation, etc., achieve the effect of reducing dosage, reducing production cost, and improving expression level

Pending Publication Date: 2020-09-11
SHENZHEN CHANGENE MEDICAL TECH CO LTD
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method brings the risk of blood-borne diseases to the transfusion recipient, and long-term transfusion can lead to the accumulation of iron in the body
2) Injection of recombinant human FIX protein, the administration cycle of this method is 1-3 times / week, the treatment cost is high, and it brings a greater economic burden to the patient
[0007] In order to make up for the deficiencies in the prior art, the purpose of the present invention is to develop a method for improving the expression level of recombinant human FIX protein in vitro, and to use the recombinant human protein in vitro to treat hemophilia B, which can avoid the blood loss caused by long-term blood transfusion. The risk of infectious diseases can reduce the production cost of recombinant human FIX protein, and it can also be used for gene therapy of hemophilia B, which is of great significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving expression level of human coagulation factor IX
  • Method for improving expression level of human coagulation factor IX
  • Method for improving expression level of human coagulation factor IX

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Replacement of Kozak sequence improves the expression of FIX

[0025] 1) Synthetic FIX gene

[0026] DNA synthesis is entrusted to a third-party company. The synthesized sequence includes: promoter, 5' UTR, the optimized FIX gene, 3' UTR, polyA tailed signal sequence, and NotI added at both ends of the sequence Enzyme recognition site gcggccgc. After sequencing, the sequence is completely correct.

[0027] 2) Linearization of FIX expression sequence and AAV expression vector

[0028] The reaction system is:

[0029] DNA 1 μg

[0030] 10×Buffer 5μL

[0031] NotI restriction endonuclease 1 μL

[0032] wxya 2 O supplemented to 50 μL

[0033] The reaction conditions are:

[0034] 37℃, 1-16h

[0035] 3) Fragment recycling:

[0036] The reaction solution after digestion was subjected to agarose gel electrophoresis, and the agarose concentration was 1%. Electrophoresis parameters are: voltage 120V, time 30min. Cut out the target fragment under UV light. Recover u...

Embodiment 2

[0099] High expression of plasmid-mediated hFIX in HEK293 cells

[0100] 1) Construction of pCMV-F9-P2A-GFP plasmid

[0101] The green fluorescent protein GFP was cloned after the FIX gene on the above-mentioned AAV expression plasmid pAAV-F9, and the stop codon TAG of the FIX gene was removed at the same time, and the P2A sequence ggaagcggagctactaacttcagcctgctgaagcaggctggagaacgtggaggagaaccctggacct was added between the FIX gene and the GFP gene. The promoter of the above-mentioned AAV expression plasmid was replaced with the CMV promoter. The obtained plasmid was named pCMV-F9-P2A-GFP. For a schematic diagram of the plasmid see image 3 ;

[0102] 2) Transfection

[0103] HEK293T cells were seeded in 24-well plates at a cell density of 10 5 One per well, 12-16h later, transfection was performed using Lipo3000 transfection reagent. 4-6h after transfection, replace the new medium. 48h after transfection, the fluorescence of the cells could be observed under a fluorescenc...

Embodiment 3

[0107] Recombinant adeno-associated virus (AAV) mediated FIX gene to highly express human blood coagulation factor FIX in HepG2

[0108] 1) Packaging and purification of recombinant AAV virus

[0109] A three-plasmid packaging system was adopted, including the above-mentioned AAV expression plasmid pAAV-F9, the helper plasmid pHelper and the packaging plasmid pRC2 / 8.

[0110] HEK293T cells were seeded in five 15cm culture dishes. After 12-18 hours, the confluence of the cells reached 85-90%, and the cells were in good condition. The medium was replaced with serum-free DMEM medium 1-2 hours before transfection.

[0111] Prepare DNA-PEI complex: Add 124μg pHelper plasmid, 76μg pRC2 / 8 plasmid and 65.1μg pAAV-F9 plasmid to 5mL DMEM medium in turn, vortex and mix well; add 1ml PEI with a concentration of 1mg / mL to 5mL DMEM In the culture medium, vortex to mix; add PEI solution to the plasmid solution, vortex to mix, and stand at room temperature for 20 min. Evenly drop the above...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the expression level of human coagulation factor IX. The method comprises the following steps: optimizing human coagulation factor IX gene; replacing Kozak sequence; and constructing AAV (adeno-associated virus) expression plasmid by the optimized human FIX gene and Kozak sequence, and packaging the recombinant AAV. The expression level of the human coagulation factor FIX gene is remarkably improved by the optimized gene coding sequence and Kozak sequence. The optimized human FIX gene and Kozak sequence can be used for efficiently producing FIX protein for treating hemophilia B, and the production cost of the FIX protein is reduced; and the optimized human FIX gene and Kozak sequence can also be used in AAV-mediated gene replacement therapy totreat hemophilia B, the expression level of the FIX gene in human bodies is increased, so that the administration dosage is reduced, and the therapeutic effect is improved.

Description

technical field [0001] The present invention relates to the field of biochemistry, in particular to a method for improving the expression level of recombinant human coagulation factor FIX by optimizing the Kozak sequence and codons of the coding gene [0002] technical background [0003] Hemophilia B is an X-chromosome-linked hereditary blood disorder. The FIX gene encoding coagulation factor IX on the patient's X chromosome is mutated, resulting in the inability to synthesize coagulation factor IX normally. Clinically, it is manifested as prolonged coagulation time, spontaneous bleeding in severe cases, risk of teratogenic disability, and even life-threatening. At present, it mainly relies on the supplementation of active coagulation factor IX for replacement therapy, which requires life-long administration, and there is no cure. [0004] The gene encoding human blood coagulation factor IX is located on the X chromosome, with a total length of 33.5kb, including 8 exons an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/864
CPCC12N15/86C07K14/745C12N2750/14143
Inventor姜舒熊斌张芸
OwnerSHENZHEN CHANGENE MEDICAL TECH CO LTD