Method and composition for building HBV transgenic mouse model, and applications of HBV transgenic mouse model
A technology of transgenic mice and compositions, which can be applied to other methods, applications, genetic engineering and other directions of inserting foreign genetic materials, can solve the problems of low transgenic efficiency, gene silencing, restricted recombinant ES cell preparation, etc., and achieve increased expression stability. Sex, expression stabilization effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Construction of plasmids expressing sgRNA
[0030] 1. sgRNA design
[0031] The sequence information of sgRNA is shown in Table 1 below:
[0032] Table 1 sgRNA design information
[0033]
[0034] 2. Construction of U6-Roas26-sgRNA
[0035] ① Dilute the synthesized sgRNA oligonucleotides to 10 μM, prepare the system according to Table 2, and perform programmed annealing on a PCR machine to form double-stranded DNA containing BbsI cohesive ends. The reaction procedure was heating at 98°C for 10 min, and cooling to room temperature naturally.
[0036]
[0037]
[0038] Table 2 sgRNA annealing reaction system
[0039] components Volume (uL) sgRNA-S 10 sgRNA-R 10 NEB buffer 3(10×) 5 wxya 2 o
25 Total 50
[0040] ② Linearization of U6-sgRNA expression vector: U6-sgRNA expression vector was digested with BbsI restriction endonuclease, and the enzyme digestion reaction system is shown in Table 3.
[0041] Table 3...
Embodiment 2
[0064] homology arm construction
[0065] Use PCR to amplify the mouse albumin promoter sequence, connect it into the PGEM-T vector, and then connect the promoter sequence and 1.3 copies of the whole HBV genome into pcDNA3.1 to form the homology arm expression plasmid pcDNA3.1-1.3 HBV-Donor.
[0066] HBV genome sequence (SEQ ID NO.4):
[0067] aattccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaacagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattcctatgg...
Embodiment 3
[0075] Construction of transgenic ES cell lines
[0076] According to the results of the sgRNA activity detection experiment, the pU6-sgRNA with the highest activity on the target site was selected for subsequent experiments.
[0077] 1. Transfection and monoclonal screening
[0078] ① ES cells were co-transfected with 1 μg pU6-sgRNA, 1 μg pCas9 and 1 μg linearized pcDNA3.1-1.3HBV-Donor by electroporation, and pEGFR-N2 plasmid was set as the control group.
[0079] ② After 48 hours of transfection, add G418 screening medium (pre-test to determine drug screening concentration), observe and record the cell state every day, and replace fresh screening medium containing G418 every other day.
[0080] ③ After 7-10 days of G418 screening, almost all negative cells died. After the cells to be screened proliferated in large quantities, some cells were taken for limiting dilution and inoculated into 10 cm cell culture dishes so that there were about 30-40 cells in each dish, and the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


