Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

General colorimetric nucleic acid detection method based on CRISPR/Cas system, kit and application

A detection method and nucleic acid technology, applied in the field of biotechnology detection, can solve the problems of difficult promotion and high detection cost

Active Publication Date: 2020-10-30
SOUTH CHINA NORMAL UNIVERSITY
View PDF6 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the application of this method in gene detection often relies on electrophoresis technology and fluorescence quantitative technology, and it also faces the problems of difficult promotion at the grassroots level and high detection cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • General colorimetric nucleic acid detection method based on CRISPR/Cas system, kit and application
  • General colorimetric nucleic acid detection method based on CRISPR/Cas system, kit and application
  • General colorimetric nucleic acid detection method based on CRISPR/Cas system, kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] A Universal Colorimetric Nucleic Acid Detection Method Based on CRISPR / Cas System

[0054] 1. Design, transcription and purification of crRNA:

[0055] If the target nucleic acid is DNA, it is designed according to the recognition mechanism of the Cas12a protein, and if the target nucleic acid is RNA, it is designed according to the recognition mechanism of the Cas13a protein.

[0056] The crRNA transcription method of this embodiment is: T7 RNA polymerase in vitro transcription method. The reaction conditions are constant temperature at 37°C for 4 hours, and the specific reaction system is as follows:

[0057] crRNA transcription system (20μL)

[0058] Reactant Amount added Final concentration double distilled water 11μL - template DNA 0.5μL 400ng 10×RNA polymerase buffer 2μL 1× NTP mix (10mM) 4μL 2mM RNase inhibitor 0.5μL 20U T7 RNA polymerase 2μL 20U

[0059] The crRNA sequence transcribed in the ...

Embodiment 2

[0089] Detection of Transgenic Rice by Universal Colorimetric Nucleic Acid Detection Method Based on CRISPR / Cas System

[0090] 1. Genomic DNA extraction of transgenic rice

[0091] Tiangen Plant Genomic DNA Extraction Kit (Beijing Tiangen) was used to extract genomic DNA from rice with different contents of transgenics (a mixture of transgenic rice and common rice) (the transgenic rice was donated by Professor Yang Chengwei, School of Life Sciences, South China Normal University).

[0092] 2. Primer design and amplification of the target gene

[0093] The specific nucleic acid of transgenic rice is the CaMV 35S promoter sequence, and corresponding RPA amplification primers are designed for this sequence; the involved primer sequences are as follows:

[0094] CaMV35S-RPA-F: TATCCGGAAACCTCCTCGGATTCCATTGCCCAGC (SEQ ID NO: 7)

[0095]CaMV35S-RPA-R: GTGGGATTGTGCGTCATCCCCTTACGTCAGTG (SEQ ID NO: 8)

[0096] The amplified sequence of the CaMV 35S promoter is as follows:

[0097] ...

Embodiment 3

[0128] Detection of miR-17 gene by a universal colorimetric nucleic acid detection method based on CRISPR / Cas system

[0129] 1. Extraction of sample RNA

[0130] Use the RNA extraction reagent TRIzol produced by Japan TAKARA Company to extract RNA from other samples such as animal cancer tissue or cancer cells. Take a certain amount of cells and add an appropriate amount of reagents for homogenization. After standing at room temperature for 5 minutes, 12000rpm / min , 4°C, centrifuge for 5 minutes, pipette the supernatant into a new centrifuge tube; add 1 / 5 of the liquid in the tube in chloroform, shake and mix; after standing at room temperature for 5 minutes, centrifuge at 1200rpm / min, 4°C After 15 minutes, pipette the supernatant into a new tube; add an equal volume of isopropanol, invert up and down to mix, let stand for 10 minutes, centrifuge at 12000rpm / min, 4°C for 10 minutes, discard the supernatant; add 1mL to the precipitate Pre-cooled 75% ethanol, mix well, centrifu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a general colorimetric nucleic acid detection method based on a CRISPR / Cas system. The method mainly comprises the steps of (1) designing, transcribing and purifying crRNA; (2)labeling nanoparticles by using a universal probe; (3) preparing a Linker probe; (4) carrying out shearing reaction on the CRISPR / Cas system; and (5) carrying out a chromogenic reaction of the nanoparticles and reading a result. The invention further discloses a kit based on the method and application of the kit. The kit can realize naked eye room-temperature homogeneous detection, has the characteristics of strong specificity, high sensitivity, short detection time and the like, is low in cost and relatively strong in universality, and is beneficial to field inspection and popularization ofa primary medical system.

Description

technical field [0001] The invention relates to the field of biotechnology detection, in particular to a CRISPR / Cas system-based universal colorimetric nucleic acid detection method, kit and application. Background technique [0002] With the improvement of people's living standards, human beings are facing more and more threats. Humans are eager for testing technologies and reagents that can quickly identify pathogenic microorganisms to distinguish a wide variety of pathogenic microorganisms that mutate rapidly. Faced with the mixed food of genetically modified nucleic acids, human beings are also eager to quickly identify the content and hazards of genetically modified foods. However, traditional laboratory detection methods are cumbersome to operate, have a long cycle, rely on some high-precision instruments, and require relatively high technical level of operators, which cannot well meet the needs of human beings. Therefore, no matter from which aspect, it is urgent to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/53
CPCG01N33/5308Y02A50/30
Inventor 周小明元超群
Owner SOUTH CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com