General colorimetric nucleic acid detection method based on CRISPR/Cas system, kit and application
A detection method and nucleic acid technology, applied in the field of biotechnology detection, can solve the problems of difficult promotion and high detection cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] A Universal Colorimetric Nucleic Acid Detection Method Based on CRISPR / Cas System
[0054] 1. Design, transcription and purification of crRNA:
[0055] If the target nucleic acid is DNA, it is designed according to the recognition mechanism of the Cas12a protein, and if the target nucleic acid is RNA, it is designed according to the recognition mechanism of the Cas13a protein.
[0056] The crRNA transcription method of this embodiment is: T7 RNA polymerase in vitro transcription method. The reaction conditions are constant temperature at 37°C for 4 hours, and the specific reaction system is as follows:
[0057] crRNA transcription system (20μL)
[0058] Reactant Amount added Final concentration double distilled water 11μL - template DNA 0.5μL 400ng 10×RNA polymerase buffer 2μL 1× NTP mix (10mM) 4μL 2mM RNase inhibitor 0.5μL 20U T7 RNA polymerase 2μL 20U
[0059] The crRNA sequence transcribed in the ...
Embodiment 2
[0089] Detection of Transgenic Rice by Universal Colorimetric Nucleic Acid Detection Method Based on CRISPR / Cas System
[0090] 1. Genomic DNA extraction of transgenic rice
[0091] Tiangen Plant Genomic DNA Extraction Kit (Beijing Tiangen) was used to extract genomic DNA from rice with different contents of transgenics (a mixture of transgenic rice and common rice) (the transgenic rice was donated by Professor Yang Chengwei, School of Life Sciences, South China Normal University).
[0092] 2. Primer design and amplification of the target gene
[0093] The specific nucleic acid of transgenic rice is the CaMV 35S promoter sequence, and corresponding RPA amplification primers are designed for this sequence; the involved primer sequences are as follows:
[0094] CaMV35S-RPA-F: TATCCGGAAACCTCCTCGGATTCCATTGCCCAGC (SEQ ID NO: 7)
[0095]CaMV35S-RPA-R: GTGGGATTGTGCGTCATCCCCTTACGTCAGTG (SEQ ID NO: 8)
[0096] The amplified sequence of the CaMV 35S promoter is as follows:
[0097] ...
Embodiment 3
[0128] Detection of miR-17 gene by a universal colorimetric nucleic acid detection method based on CRISPR / Cas system
[0129] 1. Extraction of sample RNA
[0130] Use the RNA extraction reagent TRIzol produced by Japan TAKARA Company to extract RNA from other samples such as animal cancer tissue or cancer cells. Take a certain amount of cells and add an appropriate amount of reagents for homogenization. After standing at room temperature for 5 minutes, 12000rpm / min , 4°C, centrifuge for 5 minutes, pipette the supernatant into a new centrifuge tube; add 1 / 5 of the liquid in the tube in chloroform, shake and mix; after standing at room temperature for 5 minutes, centrifuge at 1200rpm / min, 4°C After 15 minutes, pipette the supernatant into a new tube; add an equal volume of isopropanol, invert up and down to mix, let stand for 10 minutes, centrifuge at 12000rpm / min, 4°C for 10 minutes, discard the supernatant; add 1mL to the precipitate Pre-cooled 75% ethanol, mix well, centrifu...
PUM
Property | Measurement | Unit |
---|---|---|
particle diameter | aaaaa | aaaaa |
particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap