Transgene expression vector and application thereof
An expression vector and transgenic technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as difficulty in obtaining new varieties, long breeding cycle, complicated breeding process, etc., and achieve normal fertility and seed setting rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Construction of recombinant vector
[0042]1. Cloning of LEA8981 gene
[0043] Using Physcomitrella patens cDNA as template, RT-PCR amplification was carried out, and the amplified product was connected to pGEM-T vector to construct a cloning vector named LEA8981-T. The primers used are:
[0044] 5'-GGATCCTCTTGTGTATATTGTGCGC-3' (SEQ ID NO: 4);
[0045] 5'-CACGTGTGCGGTGTCTTATTTACTAT-3' (SEQ ID NO: 5),
[0046] 扩增出的LEA8981基因长度约为0.8kb(SEQ ID NO:1:tcttgtgtat attgtgcgcatagatcggag aatttctttc tttttggatt actattctat ttcatattca atctcaagct taatcaccatgtcgacttac gatcagacca aggagatggc cggaaagaag gccgaggaga cgaaggcatt cggtgaggacaaggctgagc aagctcacgg tgccacgaag agtgctaccg gaactgctca agacaaggct agccaggcgggagattacgc aggatccaaa gctcacgacg tcaagtctgc tgcctctgat gccgctggaa cagctcaggacaagggaagc gacacgactg gagctgctaa ggatacggct caacatgtag gtgacaagac tgctgataccgctggtgcca cgaagtccaa ggctggcgaa gcgaaagacg ctgcaggaag caaggctagt gaggctggcagctacgtgag cgacaagacc tctcaaggca aagatgctgc ag...
Embodiment 2
[0052] Example 2 Transformation, cultivation and molecular identification of recombinant vector
[0053] 1. Transformation of Agrobacterium with expression vector
[0054] 1) Preparation of Competent Agrobacterium
[0055] The frozen Agrobacterium strain Agl-1 was taken out from the -80°C refrigerator, and streaked on LB plates with Amp and Rif resistance, Kan and Rif resistance, and Rif resistance, respectively. Inverted culture at 28°C for 48 hours, if Amp + and Kan + There were no colonies growing on the flat plates, and the strains in this tube could be used as the original strains for preparing competent strains. Pick a single Agrobacterium colony on the LB plate containing only Rif resistance, inoculate it in 3-5 mL of YEB liquid medium containing Rif resistance, and cultivate overnight at 200 rpm with shaking at 28°C. Take the overnight bacterial solution in 50mL of Rif-containing YEB medium at a ratio of 1:50 for further expansion until the OD 600 =0.4-0.6. Put the...
Embodiment 3
[0080] Example 3 Functional detection of stress resistance and herbicide resistance
[0081] In order to identify the characteristics of the transgenic plants, stress tests of drought, salinity and herbicide were carried out on the transgenic plants.
[0082] 1. Identification of drought resistance of transgenic upland rice
[0083] Will 100 T 3 The full-grained seeds of the transgenic upland rice lines (30 seeds per line) and the wild-type seeds were sterilized with 5% sodium hypochlorite for 5 min, rinsed with water for 3 times, and placed in a petri dish with filter paper. After 3-4 days of whitening, carefully transfer the germinated seeds to a 96-well plate with the bottom cut, and place the 96-well plate in a glass or plastic square plate filled with hogland culture medium, adjust the height so that the grown seeds The radicle can be exposed to the culture medium and cultivated in an artificial climate box with a light intensity of 800 lux, a temperature of 25°C, and 1...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More