Pichia pastoris for efficiently expressing recombinant porcine alpha1 interferon through auxiliary secretion

A high-efficiency expression technology of Pichia pastoris, which is applied in the fields of biotechnology and genetic engineering, can solve the problems of ineffective secretion and high-copy strain production performance cannot be effectively exerted, so as to achieve the production performance, improve the level, and reduce accumulation Effect

Active Publication Date: 2020-11-13
GUANGDONG HINAPHARM PHARMA CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In view of the deficiencies in the prior art above, the purpose of the present invention is to provide a Pichia pastoris that expresses recombinant porcine α1 interferon efficiently through auxiliary secretion, aiming to solve the problem of inducing the expression of recombinant porcine α1 interferon in existing high-copy strains. It cannot be folded and secreted correctly and accumulates in the cell, and cannot be effectively secreted out of the cell, so that the production performance of high-copy strains cannot be effectively exerted.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pichia pastoris for efficiently expressing recombinant porcine alpha1 interferon through auxiliary secretion
  • Pichia pastoris for efficiently expressing recombinant porcine alpha1 interferon through auxiliary secretion
  • Pichia pastoris for efficiently expressing recombinant porcine alpha1 interferon through auxiliary secretion

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Construction of porcine α1 interferon expression vector

[0028]1.1 Based on Pichia pastoris codon bias to optimize the pig's α1 interferon expression gene coding sequence according to Pichia pastoris codon bias (https: / / sg.idtdna.com / site / account / login?returnurl= %2FCodonOpt) designed the porcine α1 interferon gene sequence, which was synthesized by Jiangsu GenScript Biotechnology Co., Ltd., and its corresponding amino acid sequence is shown below (SEQ ID No.4).

[0029] CDLPQTHSLA HTRALRLLAQ MRRISPFSCL DHRRDFGSPH EAFGGNQVQK AQAMALVHEMLQQTFQLFST EGSAAAWNES LLHQFCTGLD QQLRDLEACV MQEAGLEGTP LLEEDSILAV RKYFHRLTLYLQEKSYSPCA WEIVRAEVMR SFSSSRNLQD RLRKKE

[0030] The optimized pIFNa1 sequence is (SEQ ID No.1):

[0031] aaaagagagg ctgaagcttg tgacttacca caaacccact ccttggctca cactagagctttgcgtctat tagctcagat gagaaggatt tcacccttta gttgtctgga tcataggcgt gacttcggatcaccacatga agccttcggt ggaaaccaag tacagaaggc ccaagcaatg gctctggtac atgagatgttgcagcaaacc ttccagttat tctccaccga...

Embodiment 2

[0040] Example 2 Construction of Pichia pastoris engineering bacteria secreting and expressing porcine α1 interferon

[0041]Digest the pPICZaA-pIFNa1 expression vector with SalI restriction endonuclease, cut the gel to recover the linearized expression vector, and use a voltage of 1.6kV to electrotransform into X33 Pichia competent cells or other Pichia such as GS115, KM71 and other strains In this method, the bacterial solution is spread on a YPG plate (containing 0.4 mg / ml bleomycin), and cultured at 30° C. for 2-3 days until a single colony grows. Pick a single colony, copy it to a YPG agar plate containing 0.8mg / ml bleomycin, and culture it at 30°C for 2-3 days; when the colony grows, culture it in a deep-well culture plate and induce the expression of 72 with 1.5% methanol After 1 hour, 20 μL of the supernatant of the fermentation broth was taken for SDS electrophoresis and stained to observe the interferon expression bands. As above, copy the colony grown on the YPG pl...

Embodiment 3

[0044] Example 3 Induced Expression of Recombinant Porcine Interferon α1

[0045] The Pichia strain pIFNa1-02 expressing porcine α1 interferon prepared in Example 2 was picked, inoculated in 25 mL of BMGY medium, and cultured at 30° C. and 220 rpm for 24 hours to prepare a primary seed solution. Inoculate 20mL of primary seed liquid into 200mL of BMGY medium to prepare secondary seed liquid, and culture at 30°C and 220rpm for 24 hours. All secondary seed liquids were inoculated in 5L fermenters (2L BSM medium), controlled temperature was 30°C±0.5°C, dissolved oxygen was 20%±5%, and pH=5.0±0.5. After the basal glycerol was exhausted, 10% glycerol was added continuously, until the dissolved oxygen rose to 100% after the glycerol was exhausted, starvation was performed for half an hour, methanol was added to induce the expression of Plectasin, and the total induction was 72 hours, centrifuged (6000×g, 5min ) to take the fermentation supernatant for detection.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
concentration gradientaaaaaaaaaa
concentration gradientaaaaaaaaaa
Login to view more

Abstract

The invention discloses pichia pastoris for efficiently expressing recombinant porcine alpha1 interferon through auxiliary secretion. The pichia pastoris comprises a recombinant porcine alpha1 interferon gene segment with a DNA sequence as shown in SEQ ID No. 1 and a protein disulfide isomerase PDI gene segment with a DNA sequence as shown in SEQ ID No. 2; a multi-copy recombinant porcine alpha1 interferon gene segment and a DNA segment for inserting and expressing yeast protein disulfide isomerase are integrated in pichia pastoris; the auxiliary protein is folded in yeast cells, so that accumulation of interferon in cells is reduced, the amount of the porcine alpha 1 interferon secreted out of the cells is increased, the expression quantity of the porcine interferon alpha 1 reaches 1.43 g/L and is improved by 40% or above compared with that of a bacterial strain only integrating an interferon expression cassette, the level of producing the porcine interferon alpha 1 through thallus fermentation is remarkably improved, and the production performance of a high-copy bacterial strain is effectively exerted.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and genetic engineering, in particular to a Pichia pastoris that highly expresses recombinant porcine alpha 1 interferon through auxiliary secretion. Background technique [0002] Interferon (Interferon) can be divided into type I, type II and type III according to the source, structure and receptor of the protein, and each type contains different subtypes. Currently only alpha and beta interferon in type I and gamma interferon in type II are approved for the prevention and treatment of viral infections. The porcine α1 interferon-encoding gene (PoIFNα1) was first isolated from a pig genome library by French scientists in 1986 (Lefevre and Bonnardiere, 1986). The complete open reading frame of the gene encodes a protein with a length of 189 amino acids, including a signal peptide sequence consisting of 23 amino acid residues (amino acids 1-23) and a sequence of 166 amino acid residues (amin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N15/81C12N15/66C12N15/90C12N15/21C12N15/61C12R1/84
CPCC07K14/56C12N9/90C12N15/815C12N15/66C12N15/905C12Y503/04001
Inventor 李伟付建华张志清
Owner GUANGDONG HINAPHARM PHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap