Application of perfluorooctane sulfonate in establishing bronchial pulmonary dysplasia animal model

A technology for perfluorooctane sulfonic acid and dysplasia, which can be applied in preparations for in vivo tests, active ingredients of anhydride/acid/halide, compound screening/testing, etc., can solve the problem of single pathogenesis and cannot satisfy multiple etiology research To achieve the effects of increased lung injury score, simplified alveolar structure, and aggravated interstitial fibrosis

Inactive Publication Date: 2020-11-17
PEKING UNIV FIRST HOSPITAL
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Therefore, the technical problem to be solved by the present invention is to overcome the defects that the pathogenesis of the model of bronchopulmonary dysplasia in the prior art is single and cannot satisfy the research of multiple etiologies, thereby providing perfluorooctane sulfonic acid in the preparation of animal models of bronchopulmonary dysplasia. The application and preparation method of the bronchopulmonary dysplasia model, the pathogenic mechanism not only includes the inflammatory response, which may affect fetal development by affecting angiogenesis, cell proliferation and differentiation, etc., allowing the study of bronchopulmonary dysplasia from multiple aspects and perspectives. The pathogenesis of dysplasia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of perfluorooctane sulfonate in establishing bronchial pulmonary dysplasia animal model
  • Application of perfluorooctane sulfonate in establishing bronchial pulmonary dysplasia animal model
  • Application of perfluorooctane sulfonate in establishing bronchial pulmonary dysplasia animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1 Construction and verification of animal model of bronchopulmonary dysplasia

[0048] 1. Materials and Methods

[0049] 1.1 Chemicals and reagents

[0050] PFOS, Trizol and reverse transcriptase kits were purchased from Sigma. SYBR Green qPCR kit and BCA protein detection kit were purchased from Takara. HE staining kit was purchased from Beijing Suolaibao Technology Co., Ltd. ELISA kits were purchased from Shanghai Xitang Biotechnology Co., Ltd. Antibodies and qPCR primers are listed in Table 1 and Table 2.

[0051] Table 1 Antibodies

[0052]

[0053]

[0054] Table 2 qPCR primers

[0055] Gene Forward primer (5'->3') Reverse primer (5'->3') SP-B GCATAGCCTGTTCACTGGTGT TGCCTGGCTGAGCGTTAC NLRP3 CGGTGACCTTGTGTGTGCTT GCTTGCAGCGAACACTCATC ASC TTGCTGGATGCTCTGTATGG CCAAGTAGGGCTGTGTTTGC Caspase-1 AAGGTCCTGAGGGCAAAGAG AACTTGAGGGAACCACTCGG GSDMD AAATCCTCCCGATGTCTACT CTTTAGTCTGCTTGCCGTAC HIF-α ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of bronchial pulmonary dysplasia disease animal models, and provides an application of perfluorooctane sulfonate in establishing a bronchial pulmonary dysplasia disease animal model. Progeny rats exposed to perfluorooctane sulfonate in a gestation period show pulmonary dysplasia and inflammatory infiltration through lung tissue HE dyeing, and the pathology is similar to characteristic of neobronchopulmonary dysplasia in persistent airway inflammation, alveolar structure simplification, alveolar cavity enlargement, interstitial fibrosis exacerbation and pulmonary vascular dysplasia. In conclusion, the perfluorooctane sulfonate (PFOS) widely existing in the environment is selected as an inducer, and compared with lipopolysaccharide which is widely applied at present, the pathogenesis of the perfluorooctane sulfonate not only comprises inflammatory response, but also may influence fetal development by influencing angiogenesis, cell proliferation and differentiation and the like, and perfluorooctane sulfonate molding allows the research of the pathogenesis of bronchial pulmonary dysplasia from multiple aspects and multiple angles.

Description

technical field [0001] The invention relates to the field of animal models of bronchopulmonary dysplasia, in particular to the application of perfluorooctane sulfonic acid in establishing animal models of bronchopulmonary dysplasia. Background technique [0002] Bronchopulmonary dysplasia (BPD) is one of the most common causes of premature infant death. Chinese scholars have found through multi-center research and statistics that the probability of bronchopulmonary dysplasia among premature infants aged 28-37 weeks in my country is 1.26%. Vascular-related diseases also have a great impact on the later growth of children. Therefore, it is very important to study the mechanism of bronchopulmonary dysplasia and find its effective treatment. At present, there is no uniform modeling method for bronchopulmonary dysplasia, and experimental animals are not uniform. [0003] At present, there are many methods for modeling of experimental animal bronchopulmonary dysplasia: exposure ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K49/00A61K31/185A01K67/02
CPCA01K67/02A61K31/185A61K49/0008
Inventor叶乐平张慧珊李聪
OwnerPEKING UNIV FIRST HOSPITAL