Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel coronapneumonia virus receptor ACE2 affinity adsorbent as well as preparation method and application thereof

A pneumonia virus, adsorbent technology, applied in chemical instruments and methods, other chemical processes, other medical devices, etc., can solve the problems of drug efficacy discount, function decline, complex process, etc., to achieve coupling effect and strong functionality, Improve efficiency and stability, simple structure effect

Pending Publication Date: 2020-11-27
WUHAN RUIFA MEDICAL DEVICES CO LTD
View PDF8 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the process of modifying the aptamer with this affinity column, the modification process of the aminated aptamer needs to introduce nitrogen and then modify it into an amino aptamer. The operation process will be relatively cumbersome and easily destroy the aptamer Bulk structure, resulting in a decline in function; and its overall preparation process is complex
In addition, it also has the problem of complicated steps such as end group blocking after the end of the reaction, and the reaction involves pH adjustment and the introduction of reaction steps that are corrosive to metal reactors. The preparation process is complicated and the operating conditions are demanding, which is not suitable large-scale industrial production
[0007] At present, most of the existing treatments for reducing the viral load of new coronary pneumonia on the market use drugs orally or by injection, and they need to go through the human immune system to enter the lesion area, which takes a long time and the process is relatively complicated. After screening by the human immune system , the efficacy of the drug will be greatly reduced

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel coronapneumonia virus receptor ACE2 affinity adsorbent as well as preparation method and application thereof
  • Novel coronapneumonia virus receptor ACE2 affinity adsorbent as well as preparation method and application thereof
  • Novel coronapneumonia virus receptor ACE2 affinity adsorbent as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0033] The present invention provides a method for preparing the above-mentioned novel coronavirus pneumonia receptor ACE2 affinity adsorbent, comprising the following steps:

[0034] S1, prepare the novel coronavirus pneumonia receptor ACE2 aptamer, and then carry out carboxylation functional modification on the surface of the novel coronavirus pneumonia virus receptor ACE2 aptamer to obtain the carboxylated ACE2 aptamer, and finally formulate it into a predetermined concentration of carboxyl ACE2 aptamer solution, save it for later use;

[0035] S2, preparing agarose gel microspheres, and performing amination modification on the surface of the agarose gel microspheres to obtain aminated carrier microspheres;

[0036] S3, add the aminated carrier microspheres prepared in step S2 into the EDC-NHS activator according to a predetermined ratio, suspend and stir for 10 to 20 minutes, then add the carboxylated ACE2 prepared in step S1 at room temperature to adapt body solution to ...

Embodiment 1

[0045] A preparation method of a novel coronavirus receptor ACE2 affinity adsorbent, comprising the steps of:

[0046] S1, preparing the novel coronavirus pneumonia virus receptor ACE2 aptamer, and then performing carboxylation functional modification on the surface of the novel coronavirus pneumonia virus receptor ACE2 aptamer to obtain a carboxylated ACE2 aptamer, and finally preparing a mass concentration of 1.0 ng / μL carboxylated ACE2 aptamer solution, stored at -80°C, for use; Among them, the fragment of the new coronary pneumonia virus receptor ACE2 single-stranded DNA aptamer is 108 bases, and the sequence is as follows:

[0047] CATTGGAGCAAGTGTTGGATCTTGTATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATTAGCTC;

[0048] S2, preparing 4FF agarose gel microspheres, and performing amination modification on the surface of the agarose gel microspheres to obtain aminated carrier microspheres;

[0049] Preparation of EDC-NHS carboxyl activator: Weig...

Embodiment 2-4

[0065] The difference from Example 1 is that: in the mixed reaction solution in step S3, the concentration of the carboxylated ACE2 aptamer is set differently, and the others are the same as in Example 1, and will not be repeated here.

[0066] Table 2 is the process parameter setting and virus adsorption efficiency parameter in embodiment 1-4

[0067]

[0068]

[0069] It can be seen from Table 2 that the influence of the concentration of the carboxylated ACE2 aptamer in the mixed reaction solution on the coupling effect and binding performance of the ACE2 affinity adsorbent is: when the aptamer concentration reaches 1.0ng / mL-2.0ng / mL, the virus adsorption efficiency is higher. If the concentration of the aptamer is low, it is difficult to link all the carboxyl groups on the microspheres with the aminated aptamer, and the adsorption efficiency of the microspheres is low. If the concentration is too high, it will be difficult for the single-stranded DNA to fully stretc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel coronapneumonia virus receptor ACE2 affinity adsorbent as well as a preparation method and application thereof. The novel coronapneumonia virus receptor ACE2 affinity adsorbent comprises a carrier microsphere and a novel coronapneumonia virus receptor ACE2 aptamer combined on the surface of the carrier microsphere. The surface of the carrier microsphere is modified by amino, the surface of the novel coronapneumonia virus receptor ACE2 aptamer is modified by carboxyl, and the amino on the surface of the carrier microsphere and the carboxyl on the surface of the novel coronapneumonia virus receptor ACE2 aptamer form a stable amido bond. The virus adsorbent has the advantages of simple structure, easily available raw materials, high coupling efficiency and stability, simple and controllable preparation method, one-step synthesis, high yield and good development prospect. The aptamer can be recycled after being recovered and enriched, so that the cost is greatly reduced. The novel coronavirus receptor ACE2 virus adsorbent has a huge application prospect in the field of novel coronavirus immune adsorption.

Description

technical field [0001] The present invention relates to the technical field of virus adsorption, and also to the technical field of activation and coupling of microspheres, in particular to a new coronavirus receptor ACE2 affinity adsorbent and its preparation method and application. Background technique [0002] Nucleic acid aptamer is a short oligonucleotide sequence obtained by in vitro screening, which can bind to the corresponding ligand with high affinity and strong specificity. Traditional antigen-antibody reactions have good sensitivity and specificity, and ELISA plays a pivotal role in the detection of various biomolecules. Many kits on the market are developed based on this principle. However, as a probe molecule, protein is easily denatured by environmental factors such as pH and temperature, and its synthesis is expensive. Aptamers are composed of DNA or RNA (mainly DNA), which are smaller than proteins. After enrichment by SELEX screening , can have a sensitivi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): B01J20/24B01J20/28B01J20/30A61M1/16
CPCB01J20/24B01J20/28021B01J20/22A61M1/16A61M2202/0413A61M2202/0021
Inventor 向思琪张磊王业富
Owner WUHAN RUIFA MEDICAL DEVICES CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More