Novel coronapneumonia virus receptor ACE2 affinity adsorbent as well as preparation method and application thereof
A pneumonia virus, adsorbent technology, applied in chemical instruments and methods, other chemical processes, other medical devices, etc., can solve the problems of drug efficacy discount, function decline, complex process, etc., to achieve coupling effect and strong functionality, Improve efficiency and stability, simple structure effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0033] The present invention provides a method for preparing the above-mentioned novel coronavirus pneumonia receptor ACE2 affinity adsorbent, comprising the following steps:
[0034] S1, prepare the novel coronavirus pneumonia receptor ACE2 aptamer, and then carry out carboxylation functional modification on the surface of the novel coronavirus pneumonia virus receptor ACE2 aptamer to obtain the carboxylated ACE2 aptamer, and finally formulate it into a predetermined concentration of carboxyl ACE2 aptamer solution, save it for later use;
[0035] S2, preparing agarose gel microspheres, and performing amination modification on the surface of the agarose gel microspheres to obtain aminated carrier microspheres;
[0036] S3, add the aminated carrier microspheres prepared in step S2 into the EDC-NHS activator according to a predetermined ratio, suspend and stir for 10 to 20 minutes, then add the carboxylated ACE2 prepared in step S1 at room temperature to adapt body solution to ...
Embodiment 1
[0045] A preparation method of a novel coronavirus receptor ACE2 affinity adsorbent, comprising the steps of:
[0046] S1, preparing the novel coronavirus pneumonia virus receptor ACE2 aptamer, and then performing carboxylation functional modification on the surface of the novel coronavirus pneumonia virus receptor ACE2 aptamer to obtain a carboxylated ACE2 aptamer, and finally preparing a mass concentration of 1.0 ng / μL carboxylated ACE2 aptamer solution, stored at -80°C, for use; Among them, the fragment of the new coronary pneumonia virus receptor ACE2 single-stranded DNA aptamer is 108 bases, and the sequence is as follows:
[0047] CATTGGAGCAAGTGTTGGATCTTGTATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATTAGCTC;
[0048] S2, preparing 4FF agarose gel microspheres, and performing amination modification on the surface of the agarose gel microspheres to obtain aminated carrier microspheres;
[0049] Preparation of EDC-NHS carboxyl activator: Weig...
Embodiment 2-4
[0065] The difference from Example 1 is that: in the mixed reaction solution in step S3, the concentration of the carboxylated ACE2 aptamer is set differently, and the others are the same as in Example 1, and will not be repeated here.
[0066] Table 2 is the process parameter setting and virus adsorption efficiency parameter in embodiment 1-4
[0067]
[0068]
[0069] It can be seen from Table 2 that the influence of the concentration of the carboxylated ACE2 aptamer in the mixed reaction solution on the coupling effect and binding performance of the ACE2 affinity adsorbent is: when the aptamer concentration reaches 1.0ng / mL-2.0ng / mL, the virus adsorption efficiency is higher. If the concentration of the aptamer is low, it is difficult to link all the carboxyl groups on the microspheres with the aminated aptamer, and the adsorption efficiency of the microspheres is low. If the concentration is too high, it will be difficult for the single-stranded DNA to fully stretc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


