A kind of Seneca recombinant virus of recombinant O-type foot-and-mouth disease virus vp1 gene, recombinant vaccine strain and its preparation method and application
A foot-and-mouth disease virus and recombinant virus technology, applied in the field of genetic engineering, can solve problems such as indistinguishability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0089] Acquisition of VP1 Gene of Type O Foot-and-Mouth Disease Virus
[0090] The O / BY / 2010 strain is preserved by the National Foot-and-Mouth Disease Reference Laboratory designated by the Veterinary Bureau of the Ministry of Agriculture, and the public can obtain it through a letter of entrustment approved by the Veterinary Bureau of the Ministry of Agriculture. According to the gene sequence of O / BY / 2010 strain (Genebank: JN998085), the primers for synthesizing and amplifying VP1 were designed:
[0091] OVP1-F0: 5'-gatgcaatcaggcgacgtcgagaccaaccctggccctatgaccacttcgacgggcgag-3' (SEQ ID NO. 3);
[0092] OVP1-F: 5'-ccca gcatgc ttccctttcgcagctacaagcagaagatgctgatgcaatcaggcgacgtc-3' (SEQ ID NO. 4);
[0093] OS-R: 5'-caggatcgggttgtcagaagcgggcccagggttggactccac-3' (SEQ ID NO. 5).
[0094] Among the above specific primers, the upstream primers OVP1-F and OVP1-F0 used to amplify the OVP1 fragment were introduced into the SphI restriction site and the SVA gene sequence, and the dow...
Embodiment 2
[0097] Construction of Seneca Virus Infectious Clones of Recombinant Type O Foot-and-Mouth Disease Virus VP1 Gene
[0098] The SVV / FJ / 001 strain used is preserved in the China Center for Type Culture Collection (microorganism preservation number: CCTCC NO: V201802), (disclosed in the authorized patent "Seneca Valley virus vaccine and its preparation method and application" ZL201810003888.2 , which is incorporated in this application by reference in its entirety), according to the SVA genome sequence (Genebank: KY747510), design synthetic amplification primers:
[0099] SVA-1F0: 5'-gtgaggacgaaactataggaaaggaattcctatagtcttgaaagggggggctgggcc-3' (SEQ ID NO. 6);
[0100] SVA-1F: 5'-ataggt ttaattaa tgttaagcgtctgatgagtccgtgaggacgaaactatagga-3' (SEQ ID NO. 7);
[0101] SVA-1R: 5'-gggaa gcatg ctggggcaccaggcac-3' (SEQ ID NO. 8);
[0102] SVA-2F0: 5'-gtggagtccaaccctgggcccgcttctgacaacccgatcctg-3' (SEQ ID NO. 9);
[0103] SVA-2R: 5'-ttttctaga gcggcc gct 38 -3' (SEQ ID NO. 10);
...
Embodiment 3
[0112] Rescue of Seneca Recombinant Virus with Recombinant Type O Foot-and-Mouth Disease Virus VP1 Gene and Culture Characteristics of Different Cells
[0113] 3.1 Rescue of recombinant Seneca virus
[0114] use Plasmid Plus Maxi Kit (QIAGEN company) prepares the recombinant plasmid prSVV / FJ-M-OVP1 that obtains by embodiment 2, is used for transfection when BHK-21 cell grows to 80%, in liposome Lipofectamine TM Under the mediation of 2000 (Invitrogen), 4 μg of recombinant plasmids were transfected into BHK-21 cells, and liposome controls and normal cell controls were set up at the same time, and placed in 5% CO 2 In a 37°C incubator, discard the supernatant after 6 hours of transfection, add MEM medium, continue to culture, observe the cell state and cell pathological changes, harvest the virus when about 90% of the cells are pathological, freeze and thaw repeatedly 3 times and then again Inoculate BHK-21 cells until the virus can stably produce cytopathic changes, and the ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap