Rice OsCASP1 gene and application thereof

A gene and rice technology, applied in the rice OsCASP1 gene and its application field, can solve the problems such as unfavorable plant growth, achieve the effect of improving adaptability and reducing calcium accumulation

Inactive Publication Date: 2020-12-01
GUANGXI UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Increasing the calcium content in the soil can effectively improve the stress resistance of rice and alleviate the damage of heavy metals, but high calcium is not conducive to the growth of plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice OsCASP1 gene and application thereof
  • Rice OsCASP1 gene and application thereof
  • Rice OsCASP1 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Generation of rice plants overexpressing OsCASP1 gene

[0027] The rice OsCASP1 gene was cloned into the pBR322-Pubi vector to obtain rice OsCASP1 gene overexpressed plants, the specific method is as follows:

[0028] First, the open reading frame of the rice OsCASP1 gene was amplified from the rice cDNA by PCR, with a size of 657bp. Then, use the PstI and MluI restriction sites to connect to the pBR322-Pubi vector to construct an overexpression vector, such as figure 1 As shown, finally, the constructed vector was transformed into the strain of Agrobacterium agrobacterium, and the wild-type Nipponbare rice was infected to obtain overexpressed plants, and two overexpressed plants numbered pOX-1 and pOX-2 were analyzed.

Embodiment 2

[0030] RNA extraction and gene expression analysis

[0031] In order to determine the expression level of the overexpressed plants obtained in Example 1, the roots of 7-day-old wild-type (WT) and overexpressed plants (pOX-1, pOX-2) were taken, and total RNA was extracted using Trizol reagent kit (Life technologies) , and then, use PrimeScript II 1st Strand cDNA Synthesis kit (Takara) to synthesize the first strand cDNA, and use SYBR Premix ExTaq II (Takara) for expression analysis on qTOWER 2.0 (Analytik Jena) instrument; Histone H3 is used as an internal reference, each Each experiment had three biological replicates;

[0032] The sequences of the rice OsCASP1 gene quantitative primers are TCCCGGCCTTCCTGTTCTTC (SEQ ID NO.3) and CCATGATCATGTCGCAGACG (SEQ ID NO.4);

[0033] The sequences of Histone H3 quantitative primers are GGTCAACTTGTTGATTCCCCCTCT (SEQ ID NO.5) and AACCGCAAAATCCAAAGAACG (SEQ ID NO.6);

[0034] The result is as figure 2 Shown: by figure 2 A shows that t...

Embodiment 3

[0038] Calcium Tolerance Analysis of Overexpression Plants

[0039]The wild-type (WT), oscasp1 mutant (oscasp1), and overexpression plants (pOX-1, pOX-2) with a growth period of 15 days were cultured in rice nutrient solutions containing 0.18mM and 20mM calcium, respectively, every 2 days Change the nutrient solution once, and after 14 days, take pictures and collect the roots and stems, weigh the dry weight after drying, and observe the tolerance of the overexpressed plants to calcium. The results are as follows: image 3 Shown:

[0040] Depend on image 3 A shows that under normal culture conditions (in rice nutrient solution containing 0.18mM calcium), overexpression plants (pOX-1, pOX-2) and wild type (WT), oscasp1 mutant (oscasp1) grow in the same way, however, Under high calcium conditions (in the rice nutrient solution containing 20mM calcium), the growth of overexpressed plants is obviously better than that of wild type, such as image 3 B; At the same time, the dry...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a rice OsCASP1 gene; the sequence of the gene is shown as SEQ ID NO.1; the encoded protein of the rice OsCASP1 gene contains four transmembrane structural domains; and the sequence of the encoded protein is shown as SEQ ID NO.2. In the technical scheme of the invention, an OsCASP1 over-expressed transgenic strain is constructed; and the fact that the over-expressed strain enhances the calcium tolerance under a high-calcium condition is found. OsCASP1 over-expression can induce early-stage formation of a root tip casparian band; accumulation of calcium in stems is selectively reduced; and therefore the adaptability of rice to the high-calcium environment is improved. According to the invention, the understanding of the relationship among the formation of the casparian band, calcium absorption and calcium tolerance in rice is enhanced; and a method for obtaining a high-calcium-tolerance material is provided for preventing and treating heavy metals.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to a rice OsCASP1 gene and its application. Background technique [0002] Calcium ions are one of the most abundant metal elements in soil and one of the macroelements necessary for plant growth and development, participating in many biological processes, such as: cell division and expansion, structural integrity and cell signal transduction, etc. At the same time, existing studies have shown that high-calcium substances also play an important role in preventing and controlling the harm of heavy metals to crops. Increasing the calcium content in the soil can alleviate the poisoning of various harmful metals (such as aluminum and cadmium), thereby enhancing the stress resistance of plants. However, excessive calcium ion concentration in cells is toxic and is not conducive to plant growth. [0003] The root system is an important organ for plants to absorb various ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/46
CPCC07K14/415C12N15/8271
Inventor 夏继星王志刚陈致威付珊韦秋杏张宝磊辛亚峰
Owner GUANGXI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap