Application of a Danshen transcription factor smnac78 gene and its expression vector
A technology of transcription factor and Salvia miltiorrhiza, applied in the field of plant genetic engineering, can solve problems such as the biosynthesis of tanshinone that has not been found in the SmNAC78 gene, and achieve the effect of great application value, promotion and yield promotion.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 Cloning of Danshen transcription factor SmNAC78 gene and analysis of expression differences
[0054] 1. Cloning of Danshen transcription factor SmNAC78 gene
[0055] (1) Experimental method
[0056] 1. PCR product amplification
[0057] In this experiment, the gene amplification instrument of Suzhou Dongsheng Xingye Scientific Instrument Co., Ltd. was used, and the high-fidelity enzyme of Novizan Biotechnology Co., Ltd. was used. The cDNA of Salvia miltiorrhiza was used as the template, and the primers were diluted to 10 μM. The sequence of the amplification primers was:
[0058] F: ATGGAGGGGTCAGGAAGTCCAGT;
[0059] R: TCAATAAGAAGGCCAGTAGTTATCC.
[0060] The reaction system and procedure are as follows:
[0061] (1) Prepare the following reaction mixture on ice:
[0062] Table 1 PCR amplification system
[0063]
[0064] (2) Reaction procedure:
[0065] Table 2 PCR amplification program
[0066]
[0067] 2. Purification of PCR products
[0068] ...
Embodiment 2
[0145] Example 2 Construction of Transgenic SmNAC78 Hairy Root Line
[0146] 1. Experimental method
[0147] 1. Use the Gateway system to construct an overexpression vector
[0148] The overexpression vector was constructed using Invitrogen's The Technology cloning system uses the Gateway method for cloning, and the manual has been slightly changed. The target gene was cloned into entry cloning vector pDONR221 and plant overexpression vector pK7WG2D by BP reaction and LR reaction, respectively.
[0149] (1) BP reaction: use the pLB-SmNAC78 recombinant plasmid as a template, use primers with attB sites, and the primers are:
[0150] F:
[0151] GGGGACAAGTTTTGTACAAAAAAGCAGGCTATGGAGGGGTCAGGAAGTCC;
[0152] R:
[0153] GGGGACCACTTTGTACAAGAAAGCTGGGTTCAATAAGAAGGCCAGTAGT.
[0154] Perform an in vitro recombination reaction with the pDONR221 entry vector with attP sites to generate entry clones. The BP reaction system is shown in Table 7:
[0155] Table 7 BP reaction system ...
Embodiment 3
[0194] Example 3 Changes of key enzyme gene expression and tanshinone content in SmNAC78 transgenic lines
[0195] 1. Experimental method
[0196] 1. Detection of gene expression changes of key enzymes
[0197] After the transgenic hairy roots were cultured in 6,7v liquid medium for 4 weeks, RNA was extracted to detect the difference in gene expression. The method is as follows:
[0198] (1) Generally, 50-100 mg of salvia miltiorrhiza hairy root is needed for each micro-extraction, and the plant is quickly ground into powder in liquid nitrogen by liquid nitrogen grinding method, and 50-100 mg of sample is estimated to be loaded in a centrifuge tube, and 1000 μL of cell lysate A is added, and placed Vibrate on a vortex shaker for 30 s to fully lyse.
[0199] (2) Transfer 1mL of the liquid components in the mixture obtained in the previous step to a clean 1.5mL centrifuge tube
[0200] (3) Add 300 μL of deproteinized solution B and 200 μL of WB solution into the centrifuge tu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More