Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vibrio parahaemolyticus bacteriophage and application thereof in detection of viable cell content of pandemic strains of vibrio parahaemolyticus

A hemolytic Vibrio and bacteriophage technology, applied in the field of cell detection, can solve the problems of inability to distinguish cell death/survival status, failure to provide effective results, etc., and achieve the effect of simple operation, broad market demand, simple and fast operation

Active Publication Date: 2020-12-15
YANGZHOU UNIV
View PDF19 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing PCR method uses a specific nucleic acid marker of Vibrio parahaemolyticus as a target for amplification detection, which can only measure the overall cells (including dead cells and living cells) of Vibrio parahaemolyticus, and cannot distinguish the cell dead / alive state
At present, for food and environmental samples that have been sterilized and sterilized, it is often necessary to quickly evaluate the effectiveness and reliability of the treatment method by measuring the number of surviving pathogenic bacteria cells. The existing PCR and qPCR detection methods cannot provide effective results.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vibrio parahaemolyticus bacteriophage and application thereof in detection of viable cell content of pandemic strains of vibrio parahaemolyticus
  • Vibrio parahaemolyticus bacteriophage and application thereof in detection of viable cell content of pandemic strains of vibrio parahaemolyticus
  • Vibrio parahaemolyticus bacteriophage and application thereof in detection of viable cell content of pandemic strains of vibrio parahaemolyticus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Vibrio parahaemolyticus pandemic strain-specific lysis culture fluid (reagent A) preparation

[0043] (1) Preparation of bacteriophage VppYZU84: Dilute the phage suspension gradiently and mix it with the host bacterial solution according to the ratio of the optimal multiplicity of infection (MOI=1), let it stand for 10 minutes, then add it to 10mL liquid medium, 37°C, 150r / min Cultivate for 8h. The culture solution was subjected to 6000r / min, and after 10min, the supernatant was passed through a filter membrane with a pore size of 0.22 μm and stored at 4°C.

[0044] (2) Titer determination of phage VppYZU84: after gradiently diluting the phage value-proliferating solution with SM buffer solution, take 100 μL of phage solution and 100 μL of freshly cultured host bacteria VpYZU84 and mix them for 10 minutes to make a double-layer plate, and culture at 37°C for 8 hours. Manual counting, 3 parallel experiments in each group, the average number represents the tite...

Embodiment 2

[0047] Example 2 Screening of bacteriophage VppYZU84-specific nucleic acid markers and primer design and verification

[0048] (1) Design and verification of primers for specific detection of phage VppYZU84: According to the orf7 gene in the genome sequence of VppYZU84, the designed primers were analyzed using the BLAST toolbox BioEdit software on the NCBI website. VppYZU84-orf7-Fa: 5′-GCGCCTCGGATGAATTTGTGG-3′ and VppYZU84-orf7-Rb: 5′-GCACAGGTGCAGGTTCTGGAC-3′. 扩增序列为:3’-GCGCCTCGGATGAATTTGTGGAAGCACTAGCTGAACGCTTTGACCGTCCGAAGTCTCGCATCACAACAGGTGTTTACACTGACTCGGCAACGTTCATTGACACAATCCCTGAGTGCACCAACATCGGTGTGGGTTACTACAATGAGCACACTGACCGTGAGACGCTGAACTTGAATGAGTTCTACGATACGCTTGAGCACTGCTTGAAGCCTGAGACTTGGGCTGAGCTGCCAGTGGGTGAACGTCCAGAACCTGCACCTGTGC-5’

[0049] (2) Primer specificity verification: select different Vibrio parahaemolyticus (strain VpYZU84; VpYZU64; VpYZU78; VpYZU82; VpYZU103; VpYZU105; VpYZU106; VpYZU116;), other Vibrio (Vm 21613; Vf 21612;) and other phages (VppYZU64; Vmp21613; Esp...

Embodiment 3

[0051] Determination of active cells of vibrio parahaemolyticus pandemic strain in embodiment 3 fish juice simulated contamination samples

[0052] (1) Preparation of simulated contaminated samples of fish juice: collect commercially available fresh sea bass without head and bone, collect fish meat, add water at a ratio of 1:2 and boil for 10 minutes, filter the fish juice with sterile gauze and filter paper, and take the overnight cultured VpYZU84 standard Strains, added to aseptic fish juice to make the final concentration of fish juice 10 7 CFU / mL.

[0053](2) Preparation of standard strain gradient suspension (Reagent B): Take 100 μL of VpYZU84 standard strain cultured overnight, add it to 900 μL SM buffer for 10-fold dilution, and sequentially make 1:10 incremental dilutions to prepare 10 1 、10 2 、10 3 、10 4 、10 5 、10 6 CFU / mL standard strain suspension.

[0054] (3) Sample inactivation treatment: the fish juice samples were divided into 1.5mL sterile centrifuge tu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a vibrio parahaemolyticus bacteriophage VppYZU84 and application thereof in detection of viable cell content of pandemic strains of vibrio parahaemolyticus. The vibrio parahaemolyticus bacteriophage VppYZU84 is preserved in the China Center for Type Culture Collection with the preservation number being CCTCC M 2020242 on June 28, 2020. Compared with traditional plate countand qPCR quantitative detection technologies, the method for detecting the viable cell content of the pandemic strains of the vibrio parahaemolyticus by utilizing the bacteriophage VppYZU84 has selectivity, has no cross reaction on dead cells and other strains, and is simple, convenient and rapid in operation. The method is suitable for rapid quantitative detection of viable cells of pandmic strains of the vibrio parahaemolyticus in food or environmental samples.

Description

technical field [0001] The invention relates to a vibrio parahaemolyticus phage and its application in detecting the live cell content of a pandemic strain of vibrio parahaemolyticus, belonging to the technical field of cell detection. Background technique [0002] Vibrio parahaemolyticus (Vibrio parahaemolyticus) is an important zoonotic pathogen, widely distributed in seawater, seabed sediments, seafood and preserved food. Vibrio parahaemolyticus is an important pathogen of bacterial gastroenteritis transmitted by seafood around the world. It grows fast and is subcultured every 12 minutes at a temperature of 30-37°C. It is very easy to cause food poisoning outbreaks in summer and autumn. . Vibrio parahaemolyticus can be divided into non-pathogenic strains, pathogenic strains and pandemic strains according to pathogenic factors and transmission ability. It is currently considered that those with virulence genes tdh or trh are considered pathogenic strains. Those with one ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/00C12Q1/689C12Q1/70C12Q1/6851C12Q1/06C12N15/11C12R1/92C12R1/63
CPCC12N7/00C12Q1/689C12Q1/701C12Q1/6851C12N2795/00021C12Q2531/113C12Q2545/114
Inventor 杨振泉楚怡萍张元嵩高璐胡钦周文渊饶胜其
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com