Unlock instant, AI-driven research and patent intelligence for your innovation.

Human parathyroid hormone eukaryotic expression recombinant plasmid vector and construction method thereof

A technology of parathyroid hormone and eukaryotic expression vectors, applied in the field of recombinant plasmid vector construction, can solve the problems of increasing the difficulty of drug use, limiting large-scale use, instability, etc., and achieves easy large-scale standardized production, easy storage and transportation, The effect of stable performance

Pending Publication Date: 2020-12-29
深圳市瑞普逊科技有限公司
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the existing recombinant human parathyroid hormone preparations have deficiencies, which affect clinical use
First of all, recombinant PTH metabolizes quickly in the body and is very unstable. It needs regular daily medication to maintain blood drug concentration, which increases the difficulty of medication and affects the curative effect. , nausea and vomiting; the greater limitation is that the treatment of this product cannot exceed 24 months at the longest, and the patient can only be introduced once in a lifetime for a maximum of 24 months of treatment
The third is the high cost of preparation: due to the low content of PTH expression products, separation and purification are difficult, resulting in high preparation costs and expensive drugs, which limit large-scale use
No patents have been found on the construction of PTH recombinant plasmid expression vectors for gene therapy through patent searches

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human parathyroid hormone eukaryotic expression recombinant plasmid vector and construction method thereof
  • Human parathyroid hormone eukaryotic expression recombinant plasmid vector and construction method thereof
  • Human parathyroid hormone eukaryotic expression recombinant plasmid vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Construction of recombinant plasmid vector for eukaryotic expression of human parathyroid hormone ( figure 2 ).

[0039] 1. Synthesis, amplification and digestion of the target gene.

[0040](1) Artificially synthesized cDNA (SEQ ID NO. 1) of human parathyroid hormone (PTH1-84aa).

[0041] (2) Using the synthesized PTH gene as a template, design primers, which are characterized in that the primers are designed based on the target gene sequence, and a BamHI restriction site is inserted at the 5' end of the upstream primer, and a BamHI restriction site is inserted at the 5' end of the downstream primer. One XhoI restriction site: p1 (BamH I): CTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGGGTGTGTGTATGTG; p2 (XhoI): CATGGTCTTTGTAGTCCTCGAGCTGGGATTTAGCTTTAGTTAATACAT. The designed primer sequences were sent to Shenggong for synthesis. Dilute the synthesized primers into a stock solution with a final concentration of 10 µmol / L.

[0042] (3) Perform PCR amplification using...

Embodiment 2

[0086] Example 2: Expression Verification

[0087] 1. PHY-PTH transfection 293T cell experiment.

[0088] (1) One day before transfection, inoculate an appropriate number of cells into the cell culture plate, so that the cell density at the time of transfection can reach 70-90%.

[0089] (2) For each transfection sample, prepare Lipofectamine® 2000-DNA mixture as follows.

[0090] a. Before use, take 10μL Lipofectamine® 2000 Transfection Reagent

[0091] For optimization without serum, dilute in medium (Opti-MEM), and vortex for 2-3s to fully mix the reagents.

[0092] b. Dilute DNA (4µg) with serum-free Opti-MEM (125µL) and mix gently.

[0093] c. Gently mix (a) the diluted Lipofectamine® 2000 with the above (b) diluted DNA as soon as possible, and incubate in a chamber for 5 minutes to form a Lipofectamine® 2000-DNA mixture.

[0094] (3) Cells were transfected in a 10 cm dish in a serum-free medium, and the transfection complex was added for 24 hours and then replaced wi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene medicines, and particularly provides a human parathyroid hormone eukaryotic expression recombinant plasmid vector and a construction method thereof. The construction method comprises the following steps of artificially synthesizing a parathyroid hormone (hPTH1-84aa) gene (SEQ ID NO.1), carrying out PCR amplification to obtain parathyroid hormone gene segments, carrying out double enzyme digestion on a PCR product by using restriction enzymes BamHI and XhoI, connecting the product with an eukaryotic expression vector plasmid PHY-810 subjected to the same enzyme digestion, converting the connected expression vector into competent bacteria, and carrying out coating and screening to obtain the human PTH gene eukaryotic expression recombinant plasmid vector (figure 1: PHY-PTH). The eukaryotic expression recombinant plasmid vector constructed by the method enables cells to highly express PTH, and can be used for gene therapy of hypoparathyroidism and osteoporosis.

Description

technical field [0001] The invention relates to the field of gene medicine, in particular to the construction of a recombinant plasmid vector for gene therapy of hypoparathyroidism. Background technique [0002] Parathyroid hormone is an active polypeptide hormone secreted by the human parathyroid gland. Its main physiological function is to maintain blood calcium balance by regulating bone cells and kidney cells, and stimulate kidney reabsorption of calcium, phosphorus secretion and bone reconstruction. It is an important peptide hormone that regulates calcium and phosphorus metabolism. [0003] Hypoparathyroidism is a disorder of calcium and phosphorus metabolism caused by insufficient secretion of parathyroid hormone caused by disease, aging and surgical injury. Hypoparathyroidism caused by disease and aging is characterized by decalcification, bone regeneration disorder, and osteoporosis; hypoparathyroidism caused by surgical injury is divided into temporary type and pe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/66C12N15/62A61K38/29A61K48/00A61K47/64A61P5/18
CPCC12N15/85C12N15/66C07K14/635A61K38/29A61K48/0008A61K48/005A61K47/64A61P5/18C12N2800/107C07K2319/43
Inventor 赵振林樊敏黄晨宸赵晨野
Owner 深圳市瑞普逊科技有限公司