Human iPS cell gene editing and screening method

A cell gene and screening method technology, applied in the field of gene editing and screening of human iPS cells, can solve the problems of expensive flow sorting instruments, high experimental conditions, and the unknown influence of human genome, etc., and achieve the convenience of single cloning Effects of selection and establishment of lines and improvement of gene editing rate

Pending Publication Date: 2021-01-26
UNION STEMCELL & GENE ENG
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Flow cytometry requires expensive flow sorting instruments and extremely high experimental conditions, and the edited gene needs to be positively expressed on iPS cells in order to screen out cells that express negatively after editing. Or low-expression genes cannot be screened because they cannot be distinguished. Therefore, it is necessary to insert a constitutively expressed resistance or fluorescent protein gene as a screening marker while editing. This requires inserting a long outer line at the editing position Source gene sequence, which may have unknown effects on the human genome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human iPS cell gene editing and screening method
  • Human iPS cell gene editing and screening method
  • Human iPS cell gene editing and screening method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 is used for the construction of human iPS cell gene editing plasmid

[0027] An integrated plasmid (hU6-sgRNA-EF1a-eSPCas9(1.1)-2A-Puro ), the main frame of the plasmid is #64139 plasmid, eSPCas9(1.1) is derived from #71814 plasmid, and the EF1a promoter sequence is derived from #60599 plasmid. (The plasmids used were purchased from ADDGENE, the endonucleases were purchased from Thermo, and the one-step cloning kit was purchased from Novozyme)

[0028]1.1 was changed to eSPCas9 (1.1), and plasmid B002 was constructed

[0029] 1.1.1 #64139 plasmid linearization

[0030] 64139 plasmid 1ug Buffer R 2ul Bsm I 1ul EcoR V 1ul ddH2O Upto 20ul

[0031] Digest overnight at 37°C, inactivate at 80°C for 20 minutes

[0032] 1.1.2 Insert fragment PCR

[0033] #71814 plasmid 1ug EcoR I Buffer 2ul EcoR I 1ul ddH2O Upto 20ul

[0034] Digest overnight at 37°C, inactivate at 80°C for 20 minutes, t...

Embodiment 2

[0055] Example 2 Human iPS cell B2M gene knockout

[0056] Endonuclease and ligase were purchased from Thermo, mTeSR1, CloneR, ACCUTASE, and Metrigel were purchased from STEMCELL, and electroporation reagents were purchased from Lonza.

[0057] 2.1 Insert the B2M sgRNA sequence to construct the B2M knockout working plasmid (C003),

[0058] 2.1.1 sgRNA sequence primer synthesis: synthesize the following primers

[0059] B2Msg-F CACCGCGCGAGCACAGCTAAGGCCA seq ID No: 9 B2Msg-R AAACTGGCCTTAGCTGTGCTCGCGC seq ID No: 10

[0060] ddH2O dissolved primers to 10uM,

[0061] 2.1.2 B003 plasmid linearization

[0062] B003 plasmid 1ug FastDigest BpiI 1ul 10×FastDigest buffer 2ul ddH2O Upto 20ul

[0063] 37°C for 30 minutes

[0064] 2.1.3 Annealing dilution of sgRNA sequence

[0065] B2Msg-F (10uM) 4.5ul B2Msg-R (10uM) 4.5ul 10×PCR buffer 1ul

[0066] Put the PCR tube containing the mixture into a ...

Embodiment 3

[0085] Example 3 Editing Result Identification

[0086] 3.1 Cell line DNA extraction

[0087] When the iPS cells grow to cover 70% of the bottom of the well, aspirate the medium, add 1ml DPBS to each well to wash the residual medium, then aspirate and discard, add 1ml 0.5mM EDTA solution to each well, incubate at 37°C for 10 minutes, use a 1ml pipette Repeatedly blow and wash the bottom of the plate, transfer all the liquid to a 1.5ml centrifuge tube, centrifuge at 300g for 5 minutes, and remove the supernatant. Using Tiangen Whole Blood Genomic DNA Extraction Kit, follow the instructions to extract DNA.

[0088] 3.2 Sequencing detection of editing results

[0089] Primers B2M-F: CAGCAAGGACATAGGGAGGAAC (seq ID No: 11) and B2M-R: CACCAAGGAGAACTTGGAGAAG (seq ID No: 12) were used for amplification, and the product was sequenced by Sanger method. The sequencing results of the cell line numbered EK33 are as follows: figure 2 As shown, the results show that the genome lost 2 ba...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a human iPS cell gene editing and screening method. The method comprises the following steps: introducing editing plasmids into iPS cells by an electroporation method; producing gene-edited cells through resistance screening and enrichment; and performing low-density passage, and selecting monoclonal cell colonies for enlarged culture and identification. An EF1 alpha promoter is used for promoting free plasmids capable of simultaneously promoting Cas9 and screening resistance protein expression in human iPS cells, after the plasmids enter the human iPS cells, Cas9 protein and resistance protein can be transiently and stably expressed in the cells at the same time, and in the most vigorous time period of plasmid transcriptional expression, screened substances are added into a culture environment. The iPS cells which obtain exogenous plasmids and express the resistance protein survive, besides, the expressed Cas9 protein is guided by sgRNA to be subjected to double-strand cleavage at the target sequence position of a genome for gene editing, and the cells which do not obtain the exogenous plasmids or are not expressed by the plasmids die due to the fact that the cells do not contain resistance. Use of a flow cytometry or insertion of exogenous genes into the cell genome is avoided.

Description

technical field [0001] The present invention relates to a method for gene editing and screening of cells, especially a method for gene editing and screening of human iPS cells, specifically, a method for gene knockout mediated by CRISPR / Cas9 and enrichment by resistance screening , and then the method of cell selection. Background technique [0002] CRISPR-Cas9 is an adaptive immune defense formed during the long-term evolution of bacteria and archaea, which can be used to fight against invading viruses and foreign DNA. The CRISPR-Cas9 gene editing technology is a technology for specific DNA modification of targeted genes, and this technology is also a cutting-edge method for gene editing. The Cas9 enzyme protein can generate double-strand breaks at specific positions in the genome under the guidance of gRNA, thereby stimulating the DNA damage repair mechanism in cells. There are two main mechanisms for intracellular repair of DNA double-strand breaks: one is the non-homolo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N5/10C12N15/65
CPCC12N15/85C12N5/0696C12N9/22C12N15/65C12N2800/107C12N2510/00
Inventor杜宏伟杜为刘容志崔丽娟徐迎张金美张宇杨文玲
OwnerUNION STEMCELL & GENE ENG