Method for inhibiting coronavirus by anhydride-modified protein

A coronavirus and protein technology, applied in the field of biomedicine, can solve problems such as no new coronavirus specific drugs

Active Publication Date: 2021-02-05
SHANXI JINBO BIO PHARMA CO LTD +3
View PDF15 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] From the results of these clinical trials, we can know that there is currently no specific drug against the new coronavirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inhibiting coronavirus by anhydride-modified protein
  • Method for inhibiting coronavirus by anhydride-modified protein
  • Method for inhibiting coronavirus by anhydride-modified protein

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0036] Methods for preparing formulations known in the art can be found, for example, in "Remington's Pharmaceutical Sciences" (19th Ed.), Ed. A. Gennaro, 1995, Mack Publishing Company, Easton, Pa. Formulations for parenteral administration may, for example, contain excipients, sterile water or saline, poly(alkylene) glycols such as polyethylene glycol, vegetable oils or hydrogenated naphthalenes. Biocompatible, biodegradable lactide polymers, lactide / glycolide copolymers, or polyoxyethylene-polyoxypropylene copolymers can be used to control the release of the compounds. Other potentially useful parenteral delivery systems include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients such as lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be in the form of nasal drops or Oily solution applied a...

Embodiment 1

[0047] Embodiment 1: the preparation of the protein of acid anhydride modification

[0048] Preparation of 3HP-HSA

[0049] (1) 3-hydroxyl-phthalic anhydride (3HP) is formulated with dimethyl sulfoxide (DMSO) into a mother liquor with a concentration of 1M;

[0050] (2) Prepare a disodium hydrogen phosphate solution (pH8.5) with a concentration of 0.1M, add human serum albumin to make an HSA solution, and the HSA concentration is 20 mg / ml;

[0051] (3) Add the acid anhydride solution prepared in step (1) to the HSA solution to be modified, so that the final concentration of the added acid anhydride is 12mM, mix well, adjust the pH of the protein solution to 9.0 with 4M NaOH solution, and incubate at 25°C for 20min ;

[0052] (4) Repeat step (3) for a total of five times, each time the final concentration of acid anhydride is 12mM, 24mM, 36mM, 48mM, 60mM, that is, the final concentration of acid anhydride in the solution is 60mM, and incubate at 25°C for 2h to complete the ...

Embodiment 2

[0075] Embodiment 2: the effect of the protein modified by acid anhydride on coronavirus live virus

[0076] Preparation of pseudovirus

[0077](1) Codon optimization was performed on the envelope protein (S protein) gene sequence of the new coronavirus SARS-CoV-2, and gene synthesis was carried out. The information is as follows.

[0078] SARS-CoV-2S protein gene sequence (synthesized by GenScript Biotechnology Co., Ltd.):

[0079] ATGCCCATGGGGTCTCTGCAACCGCTGGCCACCTTGTACCTGCTGGGGATGCTGGTCGCTT CCGTGCTAGCCCAGTGCGTGAACCTGACCACAAGGACCCAGCTGCCCCCTGCCTATACCAATTC CTTCACACGGGGCGTGTACTATCCCGACAAGGTGTTTAGAAGCTCCGTGCTGCACTCTACACAG GATCTGTTTCTGCCTTTCTTTAGCAACGTGACCTGGTTCCACGCCATCCACGTGAGCGGCACCA ATGGCACAAAGCGGTTCGACAATCCAGTGCTGCCCTTTAACGATGGCGTGTACTTCGCCTCTAC CGAGAAGAGCAACATCATCAGAGGCTGGATCTTTGGCACCACACTGGACTCCAAGACACAGTC TCTGCTGATCGTGAACAATGCCACCAACGTCGTGATCAAGGTGTGCGAGTTCCAGTTTTGTAAT GATCCTTTCCTGGGCGTGTACTATCACAAGAACAATAAGAGCTGGATGGAGTCCGAGTTTCGCG TGTATTCTAGCGCCAACAATTGCACATTTGAGTACG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for inhibiting coronavirus growth, preventing, or controlling coronavirus infected cells in vitro by an anhydride-modified protein or a composition comprising an anhydride-modified protein. The invention also provides application of the anhydride-modified protein or the composition containing the anhydride-modified protein in preparation of medicines. The protein isselected from albumin, beta lactoglobulin and RNAase; and the anhydride is selected from 3-hydroxyphthalic anhydride, succinic anhydride or maleic anhydride. The anhydride-modified protein can effectively inactivate coronavirus in vivo or in vitro and is non-toxic to cells, and a method for controlling coronavirus epidemic situation is provided.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a method for preventing and controlling novel coronavirus by an acid anhydride-modified protein. Background technique [0002] The World Health Organization (WHO) declared the outbreak of the novel coronavirus disease (COVID-19) a Public Health Emergency of International (PHEIC). Related studies have shown that the clinical manifestations of novel coronavirus disease (COVID-19) range from asymptomatic or mild upper respiratory disease to moderate and severe disease, rapidly progressive pneumonia, respiratory failure, acute respiratory distress syndrome and multiple organ failure and fatal. [0003] At present, the prevention and control of the novel coronavirus epidemic mainly relies on diagnosis and isolation, and symptomatic and supportive treatment for patients. Specific drugs and vaccines for the disease are in preclinical or clinical trials. Some antiviral drugs that have shown...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K47/54A61K38/38A61K38/17A61K38/46A61P31/14
CPCA61K47/54A61K38/38A61K38/385A61K38/1709A61K38/465A61P31/14
Inventor姜世勃陆路刘叔文钟南山杨子峰李琳夏帅花晨杨霞王茜
OwnerSHANXI JINBO BIO PHARMA CO LTD