CRISPR/Cas9 vector suitable for phomopsis sp. FS508 as well as construction method and application of CRISPR/Cas9 vector

A technology of Phomopsis and a construction method, applied in the field of molecular biology, can solve problems such as low knockout efficiency, and achieve the effect of promoting development and utilization

Active Publication Date: 2021-02-12
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The CRISPR / Cas9 system has been widely used in genome editing of eukaryotic cells such as mammalian cells, stem cells, and plants due to its simple construction, relatively high gene knockout efficiency, and low cost. However, due to the unique habitat of deep-sea fungi The resulting relatively complex genetic background, and the relatively low knockout efficiency of the CRISPR / Cas9 system in filamentous fungi needs further optimization. At present, the CRISPR / Cas9 system has not been applied to the gene knockout of the deep-sea fungus Phomopsis.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/Cas9 vector suitable for phomopsis sp. FS508 as well as construction method and application of CRISPR/Cas9 vector
  • CRISPR/Cas9 vector suitable for phomopsis sp. FS508 as well as construction method and application of CRISPR/Cas9 vector
  • CRISPR/Cas9 vector suitable for phomopsis sp. FS508 as well as construction method and application of CRISPR/Cas9 vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Construction of targeting lithocarpins biosynthesis gene knockout vector

[0026] Design the target sequence 5'-gagaaggcttacgctcaggt-3' of the KS module.

[0027] On the basis of the pFC332 plasmid, pFC332 was digested with PacI and BglII sites, and a sequence was inserted: 5S rRNA-KS-sgRNA fragment (that is, 5S rRNA promoter-targeting sequence-sgRNA-sgRNA terminator, which is contained in The applicable 5S rRNA promoter in P.lithocarpus FS508, the sgRNA targeting sequence backbone gene and its terminator in P.lithocarpus FS508) enable the recombinant plasmid to stably express Cas9 protein and transcription sgRNA (the plasmid was named pFC332-sgRNA-KS). The primer 5S rRNA-sgRNA-F contains the target sequence gagaaggcttacgctcaggt in the KS module.

[0028] The primers designed for constructing the vector are shown in Table 1, and the pFC332-sgRNA-KS vector was constructed by restriction enzyme ligation. The construction method is as follows:

[0029] Table...

Embodiment 2

[0034] Example 2: Knockout of P. lithocarpus FS508 lithocarpins biosynthetic genes:

[0035] The method for introducing exogenous genes into P.lithocarpus FS508 protoplasts is as follows:

[0036] (1) The preparation method of P.lithocarpus FS508 protoplasts is as follows:

[0037] Pick an appropriate amount of mycelium of P.lithocarpus FS508 and inoculate it in 200mL PDB liquid medium, and culture it at 30°C and 180r / min for 7 days. Filter the bacterial solution with two layers of gauze, select 2 g (wet weight) of well-growth bacterial spheres into a 50 mL centrifuge tube, and wash twice with PBS buffer to fully wash away the residual PDB medium. Weigh 0.10g lyase and dissolve in 20mL KC buffer (0.6M KCl, 0.05M CaCl 2 ), and filtered with a 0.22 μm filter membrane, and added to the washed bacterial balls. Cleavage at 28°C and 68rpm for about 3 hours. Filter the lysate with a 200-mesh filter, filter the mycelium, and then filter again with 6 layers of lens tissue, centrifu...

Embodiment 3

[0043] Embodiment 3: comparative analysis of lithocarpins in KS mutant strain and wild strain

[0044] Comparative analysis of the production of novel lithocarpins compounds from wild P.lithocarpus FS508 and recombinant P.lithocarpus FS508.

[0045] Recombinant P.lithocarpus FS508 (KS mut P.lithocarpus FS508) and wild P.lithocarpus FS508 were inoculated, cultured in YPD medium, and cultured at 28°C for 7 days. Fermentation broths of wild and recombinant P.lithocarpus FS508 were collected, extracted with an equal volume of ethyl acetate, and concentrated by rotary evaporation. The ethyl acetate crude extracts of wild P.lithocarpus FS508 and recombinant P.lithocarpus FS508 were analyzed by HPLC and Agilent 6430 liquid mass spectrometer, and the novel lithocarpin A and Tenellone B in P.lithocarpus FS508 were used as standards. use C 18 A column (4.6×250mm) was used for analysis and detection. The detection conditions are as follows: the eluent increases from 30% methanol to 10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas9 vector suitable for phomopsis sp. FS508 and a construction method and application of the CRISPR / Cas9 vector. According to the invention, the CRISPR / Cas9 technology is used for the first time to construct a recombinant P.lithocarpus FS508 strain with knocked-out polyketone new skeleton compound lithocarpins biosynthetic genes, and a CRISPR / Cas9 gene knockout system suitable for deep sea fungi P.lithocarpus FS508 is established,therefore, the molecular biology foundation is laid for the elucidationof the biosynthesis mechanism of the lithocarpins in the P. lithocarpus FS508 and the acquisition of more lithocarpins polyketone derivatives with remarkable anti-tumor activity.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a CRISPR / Cas9 vector suitable for Phomopsis FS508 and its construction method and application. Background technique [0002] The deep-sea fungus Phomopsis lithocarpus FS508 is a kind of Phomopsis lithocarpus from the deep sea. The fungus can produce a large number of new skeleton polyketide compounds lithocarpins of tenellone-ten-membered macrocyclic lactone with significant antitumor activity. In the early stage, seven new ten-membered macrolide hybrid tenellone ketone polyketide skeleton compounds lithocarpins A-G were obtained from the deep-sea fungus Phomopsis lithocarpus. Good selective cytotoxicity, the cytotoxicity to liver cancer cells HepG-2 is obviously stronger than that of other tumor cells, and has the potential to be developed as a lead compound of specific anti-liver cancer drugs. On this basis, the genome of P.lithocarpus FS508 was sequenced...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/80C12N15/66C12N1/15C12R1/645
CPCC12N15/113C12N15/80C12N15/66C12N2310/20C12R2001/645C12N1/145
Inventor叶伟章卫民刘珊张维阳刘桃妹李赛妮徐诗航李浩华
OwnerGUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY