Preparation method for monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application
A monoclonal antibody and lymphocyte technology, applied in the field of fish immunology, can solve the problems of disease hazards, slow progress in research on the immune mechanism of bony fish T cells, and difficulty in application, and achieve the effect of ensuring specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] This example provides a hybridoma cell line 2B2D7 that secretes a monoclonal antibody against the surface membrane protein CD3ε of tilapia T lymphocytes. The hybridoma cell line 2B2D7 was preserved in the China Type Culture Collection on August 20, 2020. Center (CCTCC), the deposit number is CCTCC NO: C2020134. And wherein said tilapia is Nile tilapia (Oreochromis niloticus).
[0037] Further, the preparation method of the above-mentioned hybridoma cell line 2B2D7 comprises the following steps:
[0038] Cloning of Nile tilapia T lymphocyte surface membrane protein CD3ε gene:
[0039] ① Extract the total RNA of Nile tilapia leukocytes, and select qualified RNA to reverse transcribe and synthesize cDNA template for later use;
[0040] ② Design a primer pair set for PCR amplification, the primer pair set includes: forward primer F1 and reverse primer R1, wherein the sequence of forward primer F1 is CCGAAGATCTGCCACCATGCTCAGCATGGGTGTC (i.e. the nucleotide sequence shown in...
Embodiment 2
[0093] This embodiment provides an anti-tilapia T lymphocyte surface membrane protein CD3ε monoclonal antibody secreted by the hybridoma cell line 2B2D7 obtained in Example 1, and the preparation process of the monoclonal antibody includes the following steps:
[0094] Ascites preparation: take 10-week-old BALB / c mice, and inject 500 μL sterile paraffin oil into each mouse intraperitoneally; 10 days later, take the hybridoma cell line 2B2D7 in good growth state, wash the medium with PBS, and 300 μL sterile PBS Resuspended cells, intraperitoneally injected 2×10 per mouse 5 Observe the immunized mice every day, and kill the immunized mice by dismounting the cervical vertebrae when their abdomens bulge and become immobile, and collect ascites; centrifuge the ascites at 2000rpm for 5 minutes, take the light yellow ascites in the middle, and store in -80°C.
[0095] Antibody purification: Take 200 μL rProtein G Agarose in a 15 mL centrifuge tube, wash with PBS three times, then add...
Embodiment 3
[0097] This example provides an application of the monoclonal antibody described in Example 2 in the study of teleost adaptive immune response.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com