Preparation method for monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application

A monoclonal antibody and lymphocyte technology, applied in the field of fish immunology, can solve the problems of disease hazards, slow progress in research on the immune mechanism of bony fish T cells, and difficulty in application, and achieve the effect of ensuring specificity

Active Publication Date: 2021-03-16
EAST CHINA NORMAL UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the lack of antibody tools for teleost fish has slowed the study of the mechanism of T cell immunity in teleost fish
Due to the complexity of transmembrane proteins, it is still difficult to express a large number of proteins that retain their complete natural structure and original functions, which makes it difficult to apply traditional monoclonal antibody preparation methods to the preparation of T lymphocy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method for monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application
  • Preparation method for monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application
  • Preparation method for monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] This example provides a hybridoma cell line 2B2D7 that secretes a monoclonal antibody against the surface membrane protein CD3ε of tilapia T lymphocytes. The hybridoma cell line 2B2D7 was preserved in the China Type Culture Collection on August 20, 2020. Center (CCTCC), the deposit number is CCTCC NO: C2020134. And wherein said tilapia is Nile tilapia (Oreochromis niloticus).

[0037] Further, the preparation method of the above-mentioned hybridoma cell line 2B2D7 comprises the following steps:

[0038] Cloning of Nile tilapia T lymphocyte surface membrane protein CD3ε gene:

[0039] ① Extract the total RNA of Nile tilapia leukocytes, and select qualified RNA to reverse transcribe and synthesize cDNA template for later use;

[0040] ② Design a primer pair set for PCR amplification, the primer pair set includes: forward primer F1 and reverse primer R1, wherein the sequence of forward primer F1 is CCGAAGATCTGCCACCATGCTCAGCATGGGTGTC (i.e. the nucleotide sequence shown in...

Embodiment 2

[0093] This embodiment provides an anti-tilapia T lymphocyte surface membrane protein CD3ε monoclonal antibody secreted by the hybridoma cell line 2B2D7 obtained in Example 1, and the preparation process of the monoclonal antibody includes the following steps:

[0094] Ascites preparation: take 10-week-old BALB / c mice, and inject 500 μL sterile paraffin oil into each mouse intraperitoneally; 10 days later, take the hybridoma cell line 2B2D7 in good growth state, wash the medium with PBS, and 300 μL sterile PBS Resuspended cells, intraperitoneally injected 2×10 per mouse 5 Observe the immunized mice every day, and kill the immunized mice by dismounting the cervical vertebrae when their abdomens bulge and become immobile, and collect ascites; centrifuge the ascites at 2000rpm for 5 minutes, take the light yellow ascites in the middle, and store in -80°C.

[0095] Antibody purification: Take 200 μL rProtein G Agarose in a 15 mL centrifuge tube, wash with PBS three times, then add...

Embodiment 3

[0097] This example provides an application of the monoclonal antibody described in Example 2 in the study of teleost adaptive immune response.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a preparation method for a monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application. A hybridoma cell strain 2B2D7 is collected in China Center for Type Culture Collection (CCTCC) on August, 20, 2020 and has an accession number of CCTCC NO: C2020134. According to the preparation method and the application, CD3[epsilon] and T lymphocyte swarms of the tilapia can be sorted specifically, and an important immunologic tool can be provided for researching an adaptive immunologic mechanism of the tilapia.

Description

technical field [0001] The invention belongs to the field of fish immunology, and in particular relates to a hybridoma cell strain 2B2D7 secreting a monoclonal antibody against the surface membrane protein CD3ε of tilapia T lymphocytes, a monoclonal antibody and a preparation method and application thereof. Background technique [0002] As the main executor of the adaptive immune response, T lymphocytes perform functions such as cellular immunity and immune regulation, and clear the infection of various pathogenic microorganisms such as bacteria and viruses in the body. T cell surface glycoprotein CD3 is a marker differentiation antigen of mature T cells, which plays an important role in the development, activation and execution of immune functions of T cells. CD3 mainly has five chains of γ, δ, ε, ζ and η chains, among which the CD3ε chain mainly receives antigen stimulation signals and mediates the transmission of immune signals. CD3ε contains an Ig-like (immunoglobulin-l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N5/20C12N15/12C12N15/867C07K14/725C07K16/28G01N33/68G01N33/577A61K39/395C12R1/91
CPCC07K16/2809C07K14/7051C12N15/86G01N33/6872G01N33/577C12N2730/00043G01N2333/7051
Inventor 杨嘉龙韦秀梅李康
Owner EAST CHINA NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap