Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method for monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application

A monoclonal antibody and lymphocyte technology, applied in the field of fish immunology, can solve the problems of disease hazards, slow progress in research on the immune mechanism of bony fish T cells, and difficulty in application, and achieve the effect of ensuring specificity

Active Publication Date: 2021-03-16
EAST CHINA NORMAL UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the lack of antibody tools for teleost fish has slowed the study of the mechanism of T cell immunity in teleost fish
Due to the complexity of transmembrane proteins, it is still difficult to express a large number of proteins that retain their complete natural structure and original functions, which makes it difficult to apply traditional monoclonal antibody preparation methods to the preparation of T lymphocyte surface membrane protein CD3ε monoclonal antibodies.
[0004] In recent years, tilapia (including Nile tilapia Oreochromis niloticus), as an important freshwater aquaculture economic fish, has become more and more important in the aquaculture industry in China and even in the world. The harm caused is also becoming more and more prominent, seriously affecting the development of my country's tilapia aquaculture industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method for monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application
  • Preparation method for monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application
  • Preparation method for monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] This example provides a hybridoma cell line 2B2D7 that secretes a monoclonal antibody against the surface membrane protein CD3ε of tilapia T lymphocytes. The hybridoma cell line 2B2D7 was preserved in the China Type Culture Collection on August 20, 2020. Center (CCTCC), the deposit number is CCTCC NO: C2020134. And wherein said tilapia is Nile tilapia (Oreochromis niloticus).

[0037] Further, the preparation method of the above-mentioned hybridoma cell line 2B2D7 comprises the following steps:

[0038] Cloning of Nile tilapia T lymphocyte surface membrane protein CD3ε gene:

[0039] ① Extract the total RNA of Nile tilapia leukocytes, and select qualified RNA to reverse transcribe and synthesize cDNA template for later use;

[0040] ② Design a primer pair set for PCR amplification, the primer pair set includes: forward primer F1 and reverse primer R1, wherein the sequence of forward primer F1 is CCGAAGATCTGCCACCATGCTCAGCATGGGTGTC (i.e. the nucleotide sequence shown in...

Embodiment 2

[0093] This embodiment provides an anti-tilapia T lymphocyte surface membrane protein CD3ε monoclonal antibody secreted by the hybridoma cell line 2B2D7 obtained in Example 1, and the preparation process of the monoclonal antibody includes the following steps:

[0094] Ascites preparation: take 10-week-old BALB / c mice, and inject 500 μL sterile paraffin oil into each mouse intraperitoneally; 10 days later, take the hybridoma cell line 2B2D7 in good growth state, wash the medium with PBS, and 300 μL sterile PBS Resuspended cells, intraperitoneally injected 2×10 per mouse 5 Observe the immunized mice every day, and kill the immunized mice by dismounting the cervical vertebrae when their abdomens bulge and become immobile, and collect ascites; centrifuge the ascites at 2000rpm for 5 minutes, take the light yellow ascites in the middle, and store in -80°C.

[0095] Antibody purification: Take 200 μL rProtein G Agarose in a 15 mL centrifuge tube, wash with PBS three times, then add...

Embodiment 3

[0097] This example provides an application of the monoclonal antibody described in Example 2 in the study of teleost adaptive immune response.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method for a monoclonal antibody of T lymphocyte surface membranin CD3[epsilon] of tilapia and application. A hybridoma cell strain 2B2D7 is collected in China Center for Type Culture Collection (CCTCC) on August, 20, 2020 and has an accession number of CCTCC NO: C2020134. According to the preparation method and the application, CD3[epsilon] and T lymphocyte swarms of the tilapia can be sorted specifically, and an important immunologic tool can be provided for researching an adaptive immunologic mechanism of the tilapia.

Description

technical field [0001] The invention belongs to the field of fish immunology, and in particular relates to a hybridoma cell strain 2B2D7 secreting a monoclonal antibody against the surface membrane protein CD3ε of tilapia T lymphocytes, a monoclonal antibody and a preparation method and application thereof. Background technique [0002] As the main executor of the adaptive immune response, T lymphocytes perform functions such as cellular immunity and immune regulation, and clear the infection of various pathogenic microorganisms such as bacteria and viruses in the body. T cell surface glycoprotein CD3 is a marker differentiation antigen of mature T cells, which plays an important role in the development, activation and execution of immune functions of T cells. CD3 mainly has five chains of γ, δ, ε, ζ and η chains, among which the CD3ε chain mainly receives antigen stimulation signals and mediates the transmission of immune signals. CD3ε contains an Ig-like (immunoglobulin-l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/20C12N15/12C12N15/867C07K14/725C07K16/28G01N33/68G01N33/577A61K39/395C12R1/91
CPCC07K16/2809C07K14/7051C12N15/86G01N33/6872G01N33/577C12N2730/00043G01N2333/7051
Inventor 杨嘉龙韦秀梅李康
Owner EAST CHINA NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com