Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-IMP type carbapenemase hybridoma cell strain, monoclonal antibody and application

A technology of hybridoma cell line and carbapenemase, which is applied in the fields of application, anti-enzyme immunoglobulin, and resistance to vector-borne diseases, etc. It can solve the limitation of the range of clinical therapeutic drugs, the difficulty of clinical infection control and treatment, etc. problem, to achieve the effect of assisting clinical infection control and treatment

Active Publication Date: 2021-03-16
TIANJIN ERA BIOLOGY TECH CO LTD +1
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Clinical studies have shown that CRE strains are resistant to a variety of antimicrobial drugs, so the range of clinical treatment drugs is obviously limited
In addition, infected patients are often accompanied by concurrent diseases, which brings great difficulties to clinical infection control and treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-IMP type carbapenemase hybridoma cell strain, monoclonal antibody and application
  • Anti-IMP type carbapenemase hybridoma cell strain, monoclonal antibody and application
  • Anti-IMP type carbapenemase hybridoma cell strain, monoclonal antibody and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0124] Example 1: Preparation of anti-IMP type carbapenemase antibody

[0125] 1.1 Antigen preparation

[0126] Obtain the IMP-4 type gene sequence from NCBI, carry out the whole gene synthesis and connect it to the pet-28a vector, transform the vector plasmid pet-28a-IMP-4 containing the target gene into the expression host Rosseta (DE3), and induce the conditions When the OD value of the bacterial solution is between 0.4 and 0.6, add IPTG to a final concentration of 1mM, incubate at 37°C for 3 hours, collect the bacterial cells by centrifugation, add about 1g of bacterial cells to 30mL PBS to resuspend the bacterial cells, and then ultrasonically break the cells with a power of 400 W, sonicate for 3 s, with an interval of 5 s. After about 30 minutes, the bacterial solution is not viscous and clarified. Centrifuge to remove the bacterial fragments, pass the supernatant through a 0.45 μm filter membrane, and load the sample until the filler is filled in advance and equilibrate...

Embodiment 2

[0135] Example 2: Identification of anti-IMP-type carbapenemase antibodies

[0136] 2.1 Antibody subclass identification

[0137] According to the instructions of the SIGMA kit, the subtype identification of monoclonal antibody was carried out by the method of capture ELISA, as follows:

[0138] After diluting the monoclonal antibody subtype identification reagent 1:1000, add it to the enzyme-labeled well, 100 μL / well, incubate at 37°C for 1 hour; wash with PBST three times, and pat dry; add the antibody after diluting 1:1000 times, 100 μL / well , incubated at 37°C for 1 hour; washed three times with PBST, and patted dry; HRP enzyme-labeled goat anti-mouse IgG secondary antibody was diluted at 1:6000 and added, 100 μL / well, incubated at room temperature for 30 minutes; color development for 10-20 minutes. The subtype of the monoclonal antibody belongs to the subtype whose OD450 reading value is significantly higher than that of the subtype reagent added to other wells. The an...

Embodiment 3

[0143] Example 3: Genetic validation of anti-IMP-type carbapenemase antibodies

[0144] Ig variable region genes were cloned by RT-PCR. Extract total RNA, synthesize single-stranded cDNA, extract total RNA from 1AA4 and AH9 hybridoma cell lines by Trizol method (kit purchased from Invitrogen), and reverse total RNA to cDNA with M-MLV reverse transcriptase (purchased from Invitrogen) library.

[0145] Heavy chain framework region upstream primer

[0146] P1: 5'SAGGTGMAGCTKCASSARTCWGG3'

[0147] Heavy chain variable region downstream primer

[0148] P2: 5'TGGGGSTGTYGTTTTGGCTGMRGAGACRGTGA3'

[0149] light chain leader peptide upstream primer

[0150] P3: 5'ATGGATTTTCAAGTGCAGATTTTCAG3'

[0151] Light chain variable region downstream primer

[0152] P4: 5'GGATACAGTTGGTGCAGCATCAGCCCGTTT3'

[0153] Prepare the PCR reaction system (50 μl) as follows:

[0154] cDNA: 2μl; Upstream primer (10μM): 2μl; Downstream primer (10μM): 2μl; dNTP mixture: 2μl; pfuDNA polymerase (5U / μl): 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an anti-IMP type carbapenemase hybridoma cell strain, a monoclonal antibody and application. The hybridoma cell strain capable of stably secreting an anti-IMP type carbapenemaseantibody and a variable region sequence of the hybridoma cell strain are obtained by screening a mouse hybridoma monoclonal antibody and cloning an Ig variable region gene by an RT-PCR method, and the antibody binding specificity is identified by an ELISA method; the obtained anti-IMP type carbapenemase antibody can be used for detecting IMP type carbapenemase, the titer reaches 1:640000 or more,and the anti-IMP type carbapenemase antibody can be prepared into an in-vitro diagnostic kit or microfluidic chip for early typing of drug-resistant strains, guiding medication and assisted clinicalinfection control and treatment, and has important significance for improving the medical and health level of China.

Description

technical field [0001] The invention belongs to the technical field of antibody preparation, and in particular relates to an anti-IMP type carbapenemase hybridoma cell line, monoclonal antibody and application. Background technique [0002] Carbapenem antibiotics are one of the most effective drugs for controlling clinical pathogenic bacterial infections. Carbapenemase-producing organisms (CPOs) and carbapenem-resistant Enterobacteriaceae have become a global public health issue because of their broad-spectrum drug resistance. Sanitation issues, very limited treatment options for patients. Enterobacteriaceae are important pathogens of nosocomial and community-acquired infections. In recent years, due to the wide application of cephalosporins, the proportion of strains producing extended-spectrum beta-lactamases (ESBLs) and Amp C enzyme in Enterobacteriaceae has increased significantly, and the drug of choice for the treatment of infections caused by such strains It is a ra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/20C07K16/40C12N15/13G01N33/573G01N33/577
CPCC07K16/40G01N33/573G01N33/577C07K2317/565C07K2317/56C07K2317/35G01N2333/986C07K16/1228C07K16/1218
Inventor 苑庆华何永胜李可可陈晓玲周跃辉樊琳琳王玉芳臧丹戎
Owner TIANJIN ERA BIOLOGY TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com