Anti-VIM carbapenemase hybridoma cell strain, monoclonal antibody and application

A hybridoma cell line and carbapenemase technology, which can be used in applications, anti-enzyme immunoglobulins, instruments, etc., can solve the problems of limited range of clinical treatment drugs, clinical infection control and treatment difficulties, etc. Clinical efficacy of infection control and treatment

Active Publication Date: 2021-06-18
TIANJIN ERA BIOLOGY TECH CO LTD +3
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Clinical studies have shown that CRE strains are resistant to a variety of antimicrobial drugs, so the range of clinical treatment drugs is obviously limited
In addition, infected patients are often accompanied by concurrent diseases, which brings great difficulties to clinical infection control and treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-VIM carbapenemase hybridoma cell strain, monoclonal antibody and application
  • Anti-VIM carbapenemase hybridoma cell strain, monoclonal antibody and application
  • Anti-VIM carbapenemase hybridoma cell strain, monoclonal antibody and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0122] Embodiment 1: Preparation of anti-VIM type carbapenemase antibody

[0123] 1.1 Antigen preparation

[0124] Find and download the VIM-type carbapenemase gene sequence from NCBI, carry out the whole gene synthesis and connect it to the pet-28a vector, and transform the vector plasmid pet-28a-VIM containing the target gene into the expression host Rosseta (DE3) , the induction condition is that when the OD value of the bacterial solution is between 0.4 and 0.6, add IPTG to a final concentration of 1mM, incubate at 37 degrees for 3 hours, collect the bacterial cells by centrifugation, add about 1g of bacterial cells to 30mL PBS to resuspend the bacterial cells, and then ultrasonically break. The power is 400 W, ultrasonic 3 s, interval 5 s, after about 30 minutes, the bacterial solution is not viscous and clarified, centrifuge to remove the bacterial fragments, pass the supernatant through a 0.45 μm filter membrane, and load the sample until the filler is filled in advance...

Embodiment 2

[0133] Example 2: Identification of anti-VIM-type carbapenemase antibodies

[0134] 2.1 Antibody subclass identification

[0135] According to the instructions of the SIGMA kit, the subclass identification of monoclonal antibody was carried out by the method of capture ELISA, as follows: After diluting the monoclonal antibody subclass identification reagent at 1:1000, add it to the enzyme-labeled well, 100 μL / well, and incubate at 37 ° C for 1 h; Wash three times with PBST, pat dry; add antibody after 1:1000 dilution, 100 μL / well, incubate at 37°C for 1 h; wash three times with PBST, pat dry; HRP enzyme-labeled goat anti-mouse IgG secondary antibody diluted 1:6000 Add sample, 100 μL / well, incubate at room temperature for 30 minutes; develop color for 10-20 minutes. The subtype of the monoclonal antibody belongs to the subtype whose OD450 reading value is significantly higher than that of the subtype reagent added to other wells. The antibody subtype of antibodies 1AF6 and 1E...

Embodiment 3

[0140] Example 3: Genetic verification of anti-VIM-type carbapenemase antibodies

[0141] Ig variable region genes were cloned by RT-PCR. Extract total RNA, synthesize single-stranded cDNA, extract total RNA from 1AF6 and 1EF3 hybridoma cell lines by Trizol method (kit purchased from Invitrogen), and reverse total RNA to cDNA with M-MLV reverse transcriptase (purchased from Invitrogen) library.

[0142] Heavy chain framework region upstream primer

[0143] P1: 5'SAGGTGMAGCTKCASSARTCWGG3'

[0144] Heavy chain variable region downstream primer

[0145] P2: 5'TGGGGSTGTYGTTTTGGCTGMRGAGACRGTGA3'

[0146] light chain leader peptide upstream primer

[0147] P3: 5'ATGGATTTTCAAGTGCAGATTTTCAG3'

[0148] Light chain variable region downstream primer

[0149] P4: 5'GGATACAGTTGGTGCAGCATCAGCCCGTTT3'

[0150] Prepare the PCR reaction system (50 μl) as follows:

[0151] cDNA: 2 μl; upstream primer (10 μM): 2 μl; downstream primer (10 μM): 2 μl; dNTP mixture: 2 μl; pfuDNA polymerase (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an anti-VIM type carbapenemase hybridoma cell strain, a monoclonal antibody and application. The hybridoma cell strain capable of stably secreting the anti-VIM type carbapenemase antibody and a variable region sequence of the hybridoma cell strain are obtained by screening a mouse hybridoma monoclonal antibody and cloning an Ig variable region gene by an RT-PCR method. Through systematic evaluation, the anti-VIM type carbapenemase monoclonal antibody has better performance in all aspects, so that the anti-VIM type carbapenemase monoclonal antibody is suitable for being used as an immunodiagnostic reagent for in vitro diagnosis of VIM type carbapenemase, and the titer reaches 1: 1280000 or above; and a prepared kit or microfluidic chip can be used for early typing of drug-resistant strains, guiding medication and assisting clinical infection control and treatment.

Description

technical field [0001] The invention belongs to the technical field of antibody preparation, and in particular relates to an anti-VIM type carbapenemase hybridoma cell line, monoclonal antibody and application. Background technique [0002] Carbapenem antibiotics are one of the most effective drugs for controlling clinical pathogenic bacterial infections. Carbapenemase-producing organisms (CPOs) and carbapenem-resistant Enterobacteriaceae have become a global public health issue because of their broad-spectrum drug resistance. Sanitation issues, very limited treatment options for patients. Enterobacteriaceae are important pathogens of nosocomial and community-acquired infections. In recent years, due to the wide application of cephalosporins, the proportion of strains producing extended-spectrum beta-lactamases (ESBLs) and Amp C enzyme in Enterobacteriaceae has increased significantly, and the drug of choice for the treatment of infections caused by such strains It is a ra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/20C12N15/13C07K16/40G01N33/577G01N33/58G01N33/573C12R1/91
CPCC07K16/40G01N33/577G01N33/587G01N33/573C07K2317/56C07K2317/565G01N2333/986Y02A50/30C07K16/1217C07K16/1228
Inventor苑庆华何永胜周跃辉王玉芳臧丹戎孔迪樊琳琳黄炎彬
OwnerTIANJIN ERA BIOLOGY TECH CO LTD