Anti-KPC type carbapenemase hybridoma cell strain, monoclonal antibody and application
A hybridoma cell line and carbapenemase technology, which can be used in applications, anti-enzyme immunoglobulins, instruments, etc., can solve the problems of limited range of clinical treatment drugs, clinical infection control and treatment difficulties, etc. Clinical efficacy of infection control and treatment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0122] Example 1: Preparation of anti-KPC type carbon oxylidene antibody
[0123] 1.1 antigen preparation
[0124] Find and download the KPC type gene sequence from the NCBI to perform all gene synthesis and connect to the PET-28A vector, the carrier plasmid PET-28A-KPC containing the purpose gene is transformed into the expression host Rosseta (DE3), induced conditions When the flash liquor OD value is between 0.4 to 0.6, the final concentration of IPTG was 1 mm, 37 ° C for 3 hours, centrifugal colonization of the cell, about 1 g to add 30 ml of PBS heavy suspension, ultrasonic crush, power is 400 W, ultrasound 3 S, after about 30 minutes, after about 30 minutes, the bacterial liquid is not viscous and clarified, centrifugally removes the bacteria fragments, the upper clearance of 0.45 μm filters, and the filler is filled in advance and equilibrated with equilibrium buffer. Nickel column After the end, the imidazole concentration gradient elution was performed, and the wash wash-...
Embodiment 2
[0133] Example 2: Identification of anti-KPC type carbon oxylidene antibody
[0134] 2.1 antibody subclass identification
[0135] According to the SIGMA kit specification, the subclass identification of the monoclonal antibody was used to capture the ELISA. After the mono-macroform identification reagent 1: 1000 was diluted, 100 μl / well was added to 100 μl / well, and incubated at 37 ° C for 1 h; PBST washed three times, taking dry; 1 h then added after 1: 1000 times, 100 μl / well, 37 ° C for 1 h; PBST washed three times, taking dry; HRP enzyme lanting sheep anti-mouse IgG second anti-dilution after 1: 6000 Add the sample, 100 μl / well, and incubated for 30 min at room temperature; 93 to 20 min. The OD450 read value is significantly higher than that of the addition of the addition of other wells as the subclass type of the monoclonal. The antibody subtype of antibody 1HG11, 1HD6 is IgG1.
[0136] 2.2 antibody titer assay
[0137] After the indirect ELISA method was purified, ...
Embodiment 3
[0140] Example 3: Gene verification of anti-KPC carbon oxylidene antibody
[0141] The Ig Variable region gene is cloned by RT-PCR. Total RNA was extracted with a single-stranded cDNA, and the total RNA of 1 hg11 and 1HD6 hybridoma cell line was extracted with a Trizol method (purchased from Invitrogen), and the total RNA reverse transcriptase (purchased from invitrogen) was reversed to cDNA. library.
[0142] Heavy chain skeleton area upstream primers
[0143] P1: 5'saggtgmagctkcassartcwgg3 '
[0144] Heavy chain variable area downstream primers
[0145] P2: 5'tggggstgtygtttggctgmrgagacrgtga3 '
[0146] Light chain lead-out peptide upstream primers
[0147] P3: 5'ATGGATTTCAAGTGCAGATTTCAG3 '
[0148] Light chain variable area downstream primers
[0149] P4: 5'gatacagttggggTGCAGCATCAGCCCGTTTT3 '
[0150] The PCR reaction system (50 μL) is as follows:
[0151] CDNA: 2 μL; upstream primer (10 μm): 2 μl; downstream primer (10 μm): 2 μL; DNTP MIXTURE: 2 μL; PFUDNA polymerase (5U / μL):...
PUM
Property | Measurement | Unit |
---|---|---|
aggregation | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com