Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-KPC type carbapenemase hybridoma cell strain, monoclonal antibody and application

A hybridoma cell line and carbapenemase technology, which can be used in applications, anti-enzyme immunoglobulins, instruments, etc., can solve the problems of limited range of clinical treatment drugs, clinical infection control and treatment difficulties, etc. Clinical efficacy of infection control and treatment

Active Publication Date: 2021-06-18
TIANJIN ERA BIOLOGY TECH CO LTD +3
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Clinical studies have shown that CRE strains are resistant to a variety of antimicrobial drugs, so the range of clinical treatment drugs is obviously limited
In addition, infected patients are often accompanied by concurrent diseases, which brings great difficulties to clinical infection control and treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-KPC type carbapenemase hybridoma cell strain, monoclonal antibody and application
  • Anti-KPC type carbapenemase hybridoma cell strain, monoclonal antibody and application
  • Anti-KPC type carbapenemase hybridoma cell strain, monoclonal antibody and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0122] Example 1: Preparation of anti-KPC type carbon oxylidene antibody

[0123] 1.1 antigen preparation

[0124] Find and download the KPC type gene sequence from the NCBI to perform all gene synthesis and connect to the PET-28A vector, the carrier plasmid PET-28A-KPC containing the purpose gene is transformed into the expression host Rosseta (DE3), induced conditions When the flash liquor OD value is between 0.4 to 0.6, the final concentration of IPTG was 1 mm, 37 ° C for 3 hours, centrifugal colonization of the cell, about 1 g to add 30 ml of PBS heavy suspension, ultrasonic crush, power is 400 W, ultrasound 3 S, after about 30 minutes, after about 30 minutes, the bacterial liquid is not viscous and clarified, centrifugally removes the bacteria fragments, the upper clearance of 0.45 μm filters, and the filler is filled in advance and equilibrated with equilibrium buffer. Nickel column After the end, the imidazole concentration gradient elution was performed, and the wash wash-...

Embodiment 2

[0133] Example 2: Identification of anti-KPC type carbon oxylidene antibody

[0134] 2.1 antibody subclass identification

[0135] According to the SIGMA kit specification, the subclass identification of the monoclonal antibody was used to capture the ELISA. After the mono-macroform identification reagent 1: 1000 was diluted, 100 μl / well was added to 100 μl / well, and incubated at 37 ° C for 1 h; PBST washed three times, taking dry; 1 h then added after 1: 1000 times, 100 μl / well, 37 ° C for 1 h; PBST washed three times, taking dry; HRP enzyme lanting sheep anti-mouse IgG second anti-dilution after 1: 6000 Add the sample, 100 μl / well, and incubated for 30 min at room temperature; 93 to 20 min. The OD450 read value is significantly higher than that of the addition of the addition of other wells as the subclass type of the monoclonal. The antibody subtype of antibody 1HG11, 1HD6 is IgG1.

[0136] 2.2 antibody titer assay

[0137] After the indirect ELISA method was purified, ...

Embodiment 3

[0140] Example 3: Gene verification of anti-KPC carbon oxylidene antibody

[0141] The Ig Variable region gene is cloned by RT-PCR. Total RNA was extracted with a single-stranded cDNA, and the total RNA of 1 hg11 and 1HD6 hybridoma cell line was extracted with a Trizol method (purchased from Invitrogen), and the total RNA reverse transcriptase (purchased from invitrogen) was reversed to cDNA. library.

[0142] Heavy chain skeleton area upstream primers

[0143] P1: 5'saggtgmagctkcassartcwgg3 '

[0144] Heavy chain variable area downstream primers

[0145] P2: 5'tggggstgtygtttggctgmrgagacrgtga3 '

[0146] Light chain lead-out peptide upstream primers

[0147] P3: 5'ATGGATTTCAAGTGCAGATTTCAG3 '

[0148] Light chain variable area downstream primers

[0149] P4: 5'gatacagttggggTGCAGCATCAGCCCGTTTT3 '

[0150] The PCR reaction system (50 μL) is as follows:

[0151] CDNA: 2 μL; upstream primer (10 μm): 2 μl; downstream primer (10 μm): 2 μL; DNTP MIXTURE: 2 μL; PFUDNA polymerase (5U / μL):...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
aggregationaaaaaaaaaa
Login to View More

Abstract

The invention provides an anti-KPC type carbapenemase hybridoma cell strain, a monoclonal antibody and application. The hybridoma cell strain capable of stably secreting the anti-KPC type carbapenemase antibody and a variable region sequence of the hybridoma cell strain are obtained by screening a mouse hybridoma monoclonal antibody and cloning an Ig variable region gene by an RT-PCR method. Through systematic evaluation, the anti-KPC type carbapenemase monoclonal antibody has better performance in all aspects, so that the anti-KPC type carbapenemase monoclonal antibody is suitable for being used as an immunodiagnostic reagent for in vitro diagnosis of KPC type carbapenemase, and the titer reaches 1: 1280000 or above; and a prepared kit or microfluidic chip can be used for early typing of drug-resistant strains, guiding medication and assisting clinical infection control and treatment.

Description

Technical field [0001] The present invention belongs to the technical field of antibody preparation, and more particularly to an anti-KPC type carbon oxylidease hybrid tumor cell line, monoclonal antibody and application. Background technique [0002] Carbapenem antibiotic infection control clinical isolates one of the most effective drugs, biological production carbapenemases (CPO) and carbapenem resistance Enterobacter its broad spectrum resistance has become a global public Health issues, patient treatment is very limited. Enterus bacteria are important pathogens in hospital infection and community acquired infections. In recent years, due to the extensive use of cephalosporins, Enterobacteriaceae producing extended-spectrum β- lactamase (extended spectmbeta-lactamases, ESBLs) Strain Amp C and proportion of the enzyme was the drug of choice clear upward trend in the treatment of infections such strains It is a carbon Popular bilochemistry. However, along with imipenem and mero...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/20C07K16/40C12N15/13G01N33/577G01N33/573
CPCC07K16/40G01N33/577G01N33/573C07K2317/565C07K2317/56G01N2333/986G01N2800/26C07K16/1228
Inventor 苑庆华何永胜周跃辉王玉芳臧丹戎王亚苗王兴李世林黄炎彬
Owner TIANJIN ERA BIOLOGY TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com