A kind of rpa primer and detection method for distinguishing Proteus mirabilis and Salmonella
A technology for Proteus mirabilis and Salmonella, which is applied in microorganism-based methods, biochemical equipment and methods, and microbial determination/inspection, etc., can solve the problems of poor broad-spectrum primers and many genetic variations, and achieve excellent broad-spectrum sexual effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The selection of embodiment 1 target gene and the design of RPA primer
[0034] Using the knowledge of bioinformatics and related software, as well as the experimental discovery of the identification of bacterial types in the early stage, ureR was finally selected as the detection target of Proteus mirabilis, and dnaN was selected as the detection target of Salmonella. Download multiple ureR and dnaN sequences from the NCBI database, perform multiple sequence alignments, and design primers in the conserved regions of the sequences. Then import the primers to NCBI for blast comparison to analyze the specificity of the primers. Finally, the primer pair disclosed in the present invention is selected. Primers were synthesized by Shanghai Sangon Co., Ltd.
[0035] Primers against the virulence gene ureR of Proteus mirabilis:
[0036] Upstream primer ureR-F: 5'TATATGGTGCAAAAGGTGAGATTTGTATTA 3'(SEQ ID NO.1)
[0037] Downstream primer ureR-R: 5'ACAGATTGTAATTCAGTTTCAGACAGTAC...
Embodiment 2
[0042] Test strain
[0043] Twelve reference strains including Salmonella ATCC14028, Salmonella Kentucky, Salmonella Newport, Escherichia coli O157, and Proteus mirabilis were preserved by the food safety team laboratory of Wuhan University of Light Industry.
[0044] Preparation of bacterial DNA template
[0045] Extract the genomic DNA of the strain to be tested by boiling: culture the strain in LB liquid medium overnight, take 1 mL of the bacterial liquid and centrifuge at 12,000 rpm for 5 min, discard the supernatant; wash the cell pellet with 1 mL of sterile water, centrifuge at 12,000 rpm for 5 min, and discard it. supernatant. Add 100 μL of sterile deionized water to the precipitate to form a suspension, boil for 10 minutes, ice-bath for 5 minutes, and centrifuge at 12,000 rpm for 5 minutes. The supernatant is genomic DNA, which is used as a template for RPA amplification.
[0046] RPA amplification system
[0047] Buy TwistDX TM Company Twistamp TM Basic kit. Ad...
Embodiment 4
[0052] Example 4 Bioinformatics Analysis of Target Gene Broad Spectrum
[0053] The food isolates of Salmonella were subjected to MLST typing, hisD and dnaN genes were amplified and bidirectionally sequenced, and the full length of the genes were spliced. Wherein, the hisD sequence used in MLST alignment is shown in SEQ ID NO.5; the dnaN sequence used in MLST alignment is shown in SEQ ID NO.6. Input the gene sequence to the NCBI database for comparison, and detect the sequence homology of the target gene. image 3 The highest similarity between the hisD sequence of a certain strain with a mutation site and the Salmonella hisD gene saved in the database is only 99.5%, while Figure 4 It shows that the similarity of dnaN of a certain strain with mutation site can reach 99.87%. The compared strains all had new ST genotypes. It shows that dnaN is relatively more conservative, and using this gene as a detection target has a stronger broad spectrum.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More