OsWRKY12 and application thereof in efficient phosphorus breeding of rice

A technology for rice and uses, applied in the field of rice OsWRKY12 gene identified by reverse genetics to improve the phosphorus uptake efficiency of rice, can solve the problems that the regulatory mechanism has not yet been clarified

Active Publication Date: 2021-04-13
ZHEJIANG UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, in the overexpression material and RNAi material, the expression of some PSI genes changed, but the regulatory mechanism has not been elucidated[13]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • OsWRKY12 and application thereof in efficient phosphorus breeding of rice
  • OsWRKY12 and application thereof in efficient phosphorus breeding of rice
  • OsWRKY12 and application thereof in efficient phosphorus breeding of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, rice RNA extraction

[0050] (1) Rice cultivation

[0051] The wild-type Nipponbare seeds of rice were soaked in 1% dilute nitric acid for 16 hours to break the dormancy state. Seeds are sown on gauze boards, normal nutrient solution (recipe is shown in Table 1), and transplanted to an orifice plate supported by sponge balls after 7 days. Change the nutrient solution every 7 days. According to the needs of the experiment, select an opportunity to sample and extract RNA. For the RNA required to study the expression pattern of the OsWRKY12 gene, it was divided into 2 groups after transplanting into the well plate. One of the groups was used as a control group and cultured with normal nutrient solution; the other group was cultured with phosphorus-deficient nutrient solution (Stock-2 in Table 1 was reduced by 90%, and KCl was supplemented). After 7 days of treatment, the rice seedlings cultured in the normal nutrient solution and the phosphorus-deficient ...

Embodiment 2

[0093] Embodiment 2, construction of OsWRKY12 overexpression vector

[0094] Using the cDNA obtained in Example 1 as a template and OsWRKY12-F2: GGTACCCGGGGATCCATGCGCGGCCCGCTGCTGCT; OsWRKY12-R2: ACGCTGCAGGTCGACCTATAGCGAGAGCCGTCGCC as primers, use the Phanta MaxSuper-Fidelity DNA Polymerase (Nanjing Novaz Biotechnology Co., Ltd.) kit to amplify the desired fragment . Amplification system:

[0095]

[0096] The obtained fragment and the pCAMBIA1300 vector were digested and ligated with BamHI and SalI; transformed into Escherichia coli DH5α, picked the bacteria, expanded and shaken to extract the plasmid, and after sequencing was completely consistent with the sequence of SEQ ID NO:1, the 35S-1300-OsWRKY12 overexpression vector was obtained ( image 3 ). The vector was transformed into Agrobacterium competent EHA105 for transgenic rice.

Embodiment 3

[0097] Embodiment 3, rice transgene and T 0 Screening of positive transgenic seedlings

[0098] 1. Transgenic rice

[0099] 1 Disinfection of explants

[0100] (1) Select plump wild-type Nipponbare seeds, remove glume, and be careful not to damage the seeds;

[0101] (2) Place the seeds in a 50ml sterilized centrifuge tube, use 75% ethanol to sterilize the seeds, shake the table for 1 min, and wash twice;

[0102] (3) Use 30% sodium hypochlorite solution to sterilize the seeds, shake the bed for 30 minutes;

[0103] (4) Wash the seeds 3 times with sterilized water, shake the bed for 5 minutes each time.

[0104] 2 Induction of callus

[0105] (1) On the ultra-clean workbench, use sterilized paper towels to dry the seeds, put 15 seeds into each callus induction medium; use 0.22 μm adhesive tape (3M company) to seal the medium, and place it at 28 ° C for cultivation Induction box for 4 weeks;

[0106] (2) After 4 weeks, pick the light yellow calli and put them into the su...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice OsWRKY12 gene identified by a reverse genetics approach. The gene is induced by phosphorus deficiency at the overground part, and the root is induced by phosphorus deficiency and then recovered; and the phosphorus absorption efficiency of rice can be significantly improved by over-expression of the gene. The invention further relates to improvement of the phosphorus absorption efficiency of the rice by using the gene product. The invention discloses a protein OsWRKY12 for regulating phosphorus absorption of the rice, wherein the amino acid sequence of the protein OsWRKY12 is as shown in SEQ ID NO: 2; and the nucleotide sequence of the gene for encoding the protein is as shown in SEQ ID NO: 1.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to a rice OsWRKY12 gene identified by a reverse genetics approach. The gene is induced by phosphorus deficiency in the shoot, and the root is first induced by phosphorus deficiency and then recovered. Overexpression of the gene can significantly improve the response of rice to phosphorus. Absorption efficiency; the present invention also relates to using the gene product to improve the phosphorus absorption efficiency of rice. Background technique [0002] Phosphorus (P) is one of the macronutrient elements necessary for the normal growth and development of plants. It is an important component of metabolites such as ATP, phospholipids, and nucleic acids, as well as biological macromolecules. It participates in various biochemical processes such as phosphorylation and carbon metabolism in plants[ 1,2]. Inorganic phosphorus in the soil accounts ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/12A01H6/46
CPCC07K14/415C12N15/8243
Inventor毛传澡毛文轩徐纪明
OwnerZHEJIANG UNIV