NK trophoblast cell and application thereof
A technology of trophoblast cells and NK cells, which is applied to NK trophoblast cells and its application fields, can solve the problems of inability to apply peripheral blood, small application range, and large cell differences, and achieve simple and efficient preparation methods, low technical requirements,  The effect of low production cost
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] In this example, recombinant vectors pUC57-CD19CD86, pUC57-IL-21-CD8α, pUC57-CD64 and pUC57-CD137L were constructed. The specific steps are as follows:
[0082] Four genes, CD19CD86, IL-21-CD8α, CD64 and CD137L, were synthesized and connected to the pUC57 vector through restriction sites, which were BamHI and EcoRI.
[0083] Wherein, CD19 and CD86 are connected through the connection sequence shown in SEQ ID No.11.
[0084] SEQ ID No. 11:
[0085]GGAAGCGGAGCTACCAACTTCTCCCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGCCCC.
[0086] The constructed recombinant vectors pUC57-CD19CD86, pUC57-IL-21-CD8α, pUC57-CD64 and pUC57-CD137L were verified by enzyme digestion. The enzyme digestion system is shown in Table 1.
[0087] Table 1
[0088] components Volume (μL) recombinant vector 5μg 10× buffer 2.5 0.1%BSA 5 BamHI 2.5 EcoRI 2.5 Ultra-pure water top up to 50 total capacity 50
[0089] The digestion conditions are: water...
Embodiment 2
[0094] This example uses the recombinant vector constructed in Example 1 to construct recombinant lentivirus Lent-CD19CD86, Lent-IL-21-CD8α, Lent-CD64, Lent-CD137L and control lentivirus Lent-EGFP. The specific steps are as follows:
[0095] (1) Extraction of recombinant plasmids:
[0096] a. Take out the preserved strains, streak the plate, culture at 37°C for 12 hours, pick a single clone, add it to 5mL culture medium, shake and culture it at 37°C for 6h, take 1mL bacterial liquid and add it to 100mL culture medium, Incubate with shaking at 37°C for 12 hours;
[0097] b. Take 30mL of bacterial liquid and add it to a 50mL centrifuge tube, centrifuge at 4900g for 10min at room temperature to collect the bacterial cells, repeat the operation until all the bacterial cells in the bacterial liquid are collected;
[0098] c. Add 10mL of Solution 1 (RNase A has been added) to resuspend the bacteria;
[0099] d. Add 10 mL of Solution 2, invert up and down 10 times, and incubate at ...
Embodiment 3
[0134] In this example, the recombinant lentivirus prepared in Example 2 was used to prepare trophoblast cells and detect them. The specific steps are as follows:
[0135] (1) Recombinant lentivirus infection of K562 cells:
[0136] Cultivate K562 cells, add virus solution and mix according to the ratio of MOI of 150:1, observe the cells, and change the medium or passage according to the state of the cells;
[0137] (2) Protein level detection:
[0138] The cells after virus infection were collected, and the expression of cell membrane proteins CD64, CD19, IL-21, CD86 and CD137L was detected by quality control flow cytometry, and the test results were as follows: Figure 1A , Figure 1B , Figure 1C , Figure 1D and Figure 1E shown.
[0139] It can be seen from the figure that the expression of CD64, CD19, IL-21, CD86 and CD137L can be detected in the recombinant K562 cells, in which the expression of CD64 is 67.93%, the expression of CD19 is 98.66%, and the expression o...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



